These tools will no longer be maintained as of December 31, 2024. Archived website can be found here. PubMed4Hh GitHub repository can be found here. Contact NLM Customer Service if you have questions.


BIOMARKERS

Molecular Biopsy of Human Tumors

- a resource for Precision Medicine *

135 related articles for article (PubMed ID: 10691857)

  • 1. Jamaican Sbeta+-thalassaemia: mutations and haematology.
    Donaldson A; Old J; Fisher C; Serjeant BE; Serjeant GR
    Br J Haematol; 2000 Feb; 108(2):290-4. PubMed ID: 10691857
    [TBL] [Abstract][Full Text] [Related]  

  • 2. Hematologic phenotype of the mutations IVS1-n6 (T-->C), IVS1-n110 (G-->A), and CD39 (C-->T) in carriers of beta-thalassemia in Greece.
    Stefanis L; Kanavakis E; Traeger-Synodinos J; Tzetis M; Metaxotou-Mavromati A; Kattamis C
    Pediatr Hematol Oncol; 1994; 11(5):509-17. PubMed ID: 7530030
    [TBL] [Abstract][Full Text] [Related]  

  • 3. Molecular analysis of beta-thalassaemia patients in a high incidence area of southern Italy.
    Rigoli L; Meo A; Miceli MR; Alessio K; Caruso RA; La Rosa MA; Salpietro DC; Ricca M; Barberi I
    Clin Lab Haematol; 2001 Dec; 23(6):373-8. PubMed ID: 11843884
    [TBL] [Abstract][Full Text] [Related]  

  • 4. Determination of neutral polymorphisms (frameworks) of the human beta globin gene in beta thalassaemias by PCR/DGGE.
    Moreira HW; de Oliveira CM; Martins CS; de Sales TS; Costa FF
    Sangre (Barc); 1997 Feb; 42(1):21-4. PubMed ID: 9097718
    [TBL] [Abstract][Full Text] [Related]  

  • 5. Characterisation and confirmation of rare beta-thalassaemia mutations in the Malay, Chinese and Indian ethnic groups in Malaysia.
    Tan JA; Chin PS; Wong YC; Tan KL; Chan LL; George E
    Pathology; 2006 Oct; 38(5):437-41. PubMed ID: 17008283
    [TBL] [Abstract][Full Text] [Related]  

  • 6. Siriraj I
    Wong YY; Alauddin H; Raja Sabudin RZA; Ithnin A; Jalil N; Abdul Latiff Z; Loh CK; Alias H; Othman A
    Malays J Pathol; 2021 Apr; 43(1):95-100. PubMed ID: 33903312
    [TBL] [Abstract][Full Text] [Related]  

  • 7. Thalassaemia in Sri Lanka: implications for the future health burden of Asian populations. Sri Lanka Thalassaemia Study Group.
    de Silva S; Fisher CA; Premawardhena A; Lamabadusuriya SP; Peto TE; Perera G; Old JM; Clegg JB; Olivieri NF; Weatherall DJ
    Lancet; 2000 Mar; 355(9206):786-91. PubMed ID: 10711926
    [TBL] [Abstract][Full Text] [Related]  

  • 8. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.
    Rizo-de-la-Torre LC; Ibarra B; Sánchez-López JY; Magaña-Torres MT; Rentería-López VM; Perea-Díaz FJ
    Int J Lab Hematol; 2017 Oct; 39(5):539-545. PubMed ID: 28603845
    [TBL] [Abstract][Full Text] [Related]  

  • 9. Molecular, haematological and clinical studies of the -101 C --> T substitution of the beta-globin gene promoter in 25 beta-thalassaemia intermedia patients and 45 heterozygotes.
    Maragoudaki E; Kanavakis E; Traeger-Synodinos J; Vrettou C; Tzetis M; Metaxotou-Mavrommati A; Kattamis C
    Br J Haematol; 1999 Dec; 107(4):699-706. PubMed ID: 10606872
    [TBL] [Abstract][Full Text] [Related]  

  • 10. Genetic heterogeneity of beta thalassemia mutations in Kahramanmaraş province in Southern Turkey: preliminary report.
    Kurutaş EB; Aksan ME; Curuk P; Curuk MA
    Folia Med (Plovdiv); 2021 Oct; 63(5):697-703. PubMed ID: 35851204
    [TBL] [Abstract][Full Text] [Related]  

  • 11. Haematological and electrophoretic characterisation of β-thalassaemia in Yunnan province of Southwestern China.
    Zhang J; He J; Mao X; Zeng X; Chen H; Su J; Zhu B
    BMJ Open; 2017 Jan; 7(1):e013367. PubMed ID: 28143837
    [TBL] [Abstract][Full Text] [Related]  

  • 12. Characterisation of beta-globin gene mutations in Malaysian children: a strategy for the control of beta-thalassaemia in a developing country.
    Thong MK; Tan JA; Tan KL; Yap SF
    J Trop Pediatr; 2005 Dec; 51(6):328-33. PubMed ID: 15967770
    [TBL] [Abstract][Full Text] [Related]  

  • 13. A wider molecular spectrum of beta-thalassaemia in Myanmar.
    Win N; Harano T; Harano K; Myint TT; Mra R; Okada S; Shimono K; Myint AA
    Br J Haematol; 2002 Jun; 117(4):988-92. PubMed ID: 12060142
    [TBL] [Abstract][Full Text] [Related]  

  • 14. Beta-thalassaemia-87 C-->G: relationship of the Hb F modulation and polymorphisms in compound heterozygous patients.
    De Angioletti M; Lacerra G; Pagano L; Alessi M; D'Avino R; Manca L; Carestia C
    Br J Haematol; 2004 Sep; 126(5):743-9. PubMed ID: 15327529
    [TBL] [Abstract][Full Text] [Related]  

  • 15. Variable haematological and clinical presentation of β-thalassaemia carriers and homozygotes with the Poly A (T→C) mutation in the Indian population.
    Italia K; Sawant P; Surve R; Wadia M; Nadkarni A; Ghosh K; Colah R
    Eur J Haematol; 2012 Aug; 89(2):160-4. PubMed ID: 22690826
    [TBL] [Abstract][Full Text] [Related]  

  • 16. The Corfu delta beta thalassaemia mutation in Greece: haematological phenotype and prevalence.
    Traeger-Synodinos J; Tzetis M; Kanavakis E; Metaxotou-Mavromati A; Kattamis C
    Br J Haematol; 1991 Oct; 79(2):302-5. PubMed ID: 1720325
    [TBL] [Abstract][Full Text] [Related]  

  • 17. Beta-thalassaemia intermedia in Lebanon.
    Qatanani M; Taher A; Koussa S; Naaman R; Fisher C; Rugless M; Old J; Zahed L
    Eur J Haematol; 2000 Apr; 64(4):237-44. PubMed ID: 10776695
    [TBL] [Abstract][Full Text] [Related]  

  • 18. Hb S(C)-beta+-thalassaemia: different mutations are associated with different levels of normal Hb A.
    Gonzalez-Redondo JM; Kutlar F; Kutlar A; Stoming TA; de Pablos JM; Kilinç Y; Huisman TH
    Br J Haematol; 1988 Sep; 70(1):85-9. PubMed ID: 2460127
    [TBL] [Abstract][Full Text] [Related]  

  • 19. Mutational Analysis Of Beta Thalassaemia By Multiplex Arms-Pcr In Khyber Pakhtunkhwa, Pakistan.
    Jalil T; Yousafzai YM; Rashid I; Ahmed S; Ali A; Fatima S; Ahmed J
    J Ayub Med Coll Abbottabad; 2019; 31(1):98-103. PubMed ID: 30868793
    [TBL] [Abstract][Full Text] [Related]  

  • 20. Molecular genetic testing of beta-thalassemia patients of Indian origin and a novel 8-bp deletion mutation at codons 36/37/38/39.
    Gupta A; Hattori Y; Gupta UR; Sarwai S; Nigam N; Singhal P; Agarwal S
    Genet Test; 2003; 7(2):163-8. PubMed ID: 12885342
    [TBL] [Abstract][Full Text] [Related]  

    [Next]    [New Search]
    of 7.