These tools will no longer be maintained as of December 31, 2024. Archived website can be found here. PubMed4Hh GitHub repository can be found here. Contact NLM Customer Service if you have questions.


BIOMARKERS

Molecular Biopsy of Human Tumors

- a resource for Precision Medicine *

218 related articles for article (PubMed ID: 12885342)

  • 1. Molecular genetic testing of beta-thalassemia patients of Indian origin and a novel 8-bp deletion mutation at codons 36/37/38/39.
    Gupta A; Hattori Y; Gupta UR; Sarwai S; Nigam N; Singhal P; Agarwal S
    Genet Test; 2003; 7(2):163-8. PubMed ID: 12885342
    [TBL] [Abstract][Full Text] [Related]  

  • 2. Distribution of beta-thalassemia mutations in the Indian population referred to a diagnostic center.
    Vaz FE; Thakur CB; Banerjee MK; Gangal SG
    Hemoglobin; 2000 Aug; 24(3):181-94. PubMed ID: 10975438
    [TBL] [Abstract][Full Text] [Related]  

  • 3. Molecular genetic analyses of beta-thalassemia in South India reveals rare mutations in the beta-globin gene.
    Bashyam MD; Bashyam L; Savithri GR; Gopikrishna M; Sangal V; Devi ARR
    J Hum Genet; 2004; 49(8):408-413. PubMed ID: 15278762
    [TBL] [Abstract][Full Text] [Related]  

  • 4. Impact of beta globin gene mutations on the clinical phenotype of beta thalassemia in India.
    Colah R; Nadkarni A; Gorakshakar A; Phanasgaonkar S; Surve R; Subramaniam PG; Bondge N; Pujari K; Ghosh K; Mohanty D
    Blood Cells Mol Dis; 2004; 33(2):153-7. PubMed ID: 15315795
    [TBL] [Abstract][Full Text] [Related]  

  • 5. Spectrum of beta-thalassemia mutations and their association with allelic sequence polymorphisms at the beta-globin gene cluster in an Eastern Indian population.
    Kukreti R; Dash D; E VK; Chakravarty S; Das SK; De M; Talukder G
    Am J Hematol; 2002 Aug; 70(4):269-77. PubMed ID: 12210807
    [TBL] [Abstract][Full Text] [Related]  

  • 6. The spectrum of beta-thalassemia mutations in southern Thailand.
    Nopparatana C; Panich V; Saechan V; Sriroongrueng V; Nopparatana C; Rungjeadpha J; Pornpatkul M; Laosombat V; Fukumaki Y
    Southeast Asian J Trop Med Public Health; 1995; 26 Suppl 1():229-34. PubMed ID: 8629112
    [TBL] [Abstract][Full Text] [Related]  

  • 7. Regional distribution of beta-thalassemia mutations in India.
    Verma IC; Saxena R; Thomas E; Jain PK
    Hum Genet; 1997 Jul; 100(1):109-13. PubMed ID: 9225979
    [TBL] [Abstract][Full Text] [Related]  

  • 8. [A study on gene mutation spectrums of α- and β-thalassemias in populations of Yunnan Province and the prenatal gene diagnosis].
    Zhu BS; He J; Zhang J; Zeng XH; Su J; Xu XH; Li SY; Chen H; Zhang YH
    Zhonghua Fu Chan Ke Za Zhi; 2012 Feb; 47(2):85-9. PubMed ID: 22455737
    [TBL] [Abstract][Full Text] [Related]  

  • 9. Geographic and ethnic distribution of beta-thalassemia mutations in Uttar Pradesh, India.
    Agarwal S; Pradhan M; Gupta UR; Sarwai S; Agarwal SS
    Hemoglobin; 2000 May; 24(2):89-97. PubMed ID: 10870879
    [TBL] [Abstract][Full Text] [Related]  

  • 10. Molecular analysis of beta-thalassemia in South Vietnam.
    Svasti S; Hieu TM; Munkongdee T; Winichagoon P; Van Be T; Van Binh T; Fucharoen S
    Am J Hematol; 2002 Oct; 71(2):85-8. PubMed ID: 12353305
    [TBL] [Abstract][Full Text] [Related]  

  • 11. Study of beta-Thalassemia mutations using the polymerase chain reaction-amplification refractory mutation system and direct DNA sequencing techniques in a group of Egyptian Thalassemia patients.
    El-Gawhary S; El-Shafie S; Niazi M; Aziz M; El-Beshlawy A
    Hemoglobin; 2007; 31(1):63-9. PubMed ID: 17365006
    [TBL] [Abstract][Full Text] [Related]  

  • 12. Characterization of beta-thalassaemia mutations in 57 beta-thalassaemia families seen at Lucknow.
    Agarwal S; Naveed M; Gupta UR; Kishore P; Agarwal SS
    Indian J Med Res; 1994 Sep; 100():106-10. PubMed ID: 7959965
    [TBL] [Abstract][Full Text] [Related]  

  • 13. β-Thalassemia mutations in Western India: outcome of prenatal diagnosis in a hemoglobinopathies project.
    Patel AP; Patel RB; Patel SA; Vaniawala SN; Patel DS; Shrivastava NS; Sharma NP; Zala JV; Parmar PH; Naik MR
    Hemoglobin; 2014; 38(5):329-34. PubMed ID: 25222044
    [TBL] [Abstract][Full Text] [Related]  

  • 14. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.
    Rizo-de-la-Torre LC; Ibarra B; Sánchez-López JY; Magaña-Torres MT; Rentería-López VM; Perea-Díaz FJ
    Int J Lab Hematol; 2017 Oct; 39(5):539-545. PubMed ID: 28603845
    [TBL] [Abstract][Full Text] [Related]  

  • 15. Prenatal diagnosis in beta-thalassemia: an Indian experience.
    Agarwal S; Gupta A; Gupta UR; Sarwai S; Phadke S; Agarwal SS
    Fetal Diagn Ther; 2003; 18(5):328-32. PubMed ID: 12913343
    [TBL] [Abstract][Full Text] [Related]  

  • 16. The clinical severity of beta-thalassemia mutations in West Malaysia.
    George E
    Southeast Asian J Trop Med Public Health; 1995; 26 Suppl 1():225-8. PubMed ID: 8629111
    [TBL] [Abstract][Full Text] [Related]  

  • 17. Spectrum of beta-globin gene mutations among thalassemia patients in the West Bank region of Palestine.
    Darwish HM; El-Khatib FF; Ayesh S
    Hemoglobin; 2005; 29(2):119-32. PubMed ID: 15921164
    [TBL] [Abstract][Full Text] [Related]  

  • 18. Identification of two novel beta zero-thalassemia mutations in a Filipino family: frameshift codon 67 (-TG) and a beta-globin gene deletion.
    Eng B; Chui DH; Saunderson J; Olivieri NF; Waye JS
    Hum Mutat; 1993; 2(5):375-9. PubMed ID: 8257991
    [TBL] [Abstract][Full Text] [Related]  

  • 19. Molecular heterogeneity of beta-thalassemia in Thailand.
    Fukumaki Y; Fucharoen S; Fucharoen G; Okamoto N; Ichinose M; Jetsrisuparb A; Sriroongrueng W; Nopparatana C; Laosombat V; Panich V
    Southeast Asian J Trop Med Public Health; 1992; 23 Suppl 2():14-21. PubMed ID: 1363706
    [TBL] [Abstract][Full Text] [Related]  

  • 20. Spectrum of beta-thalassemia mutations in North Indian states: a beta-thalassemia trait with two mutations in cis.
    Chakrabarti P; Gupta R; Mishra A; Rai M; Singh VP; Dash D
    Clin Biochem; 2005 Jun; 38(6):576-8. PubMed ID: 15885239
    [TBL] [Abstract][Full Text] [Related]  

    [Next]    [New Search]
    of 11.