220 related articles for article (PubMed ID: 12885342)
1. Molecular genetic testing of beta-thalassemia patients of Indian origin and a novel 8-bp deletion mutation at codons 36/37/38/39.
Gupta A; Hattori Y; Gupta UR; Sarwai S; Nigam N; Singhal P; Agarwal S
Genet Test; 2003; 7(2):163-8. PubMed ID: 12885342
[TBL] [Abstract][Full Text] [Related]
2. Distribution of beta-thalassemia mutations in the Indian population referred to a diagnostic center.
Vaz FE; Thakur CB; Banerjee MK; Gangal SG
Hemoglobin; 2000 Aug; 24(3):181-94. PubMed ID: 10975438
[TBL] [Abstract][Full Text] [Related]
3. Molecular genetic analyses of beta-thalassemia in South India reveals rare mutations in the beta-globin gene.
Bashyam MD; Bashyam L; Savithri GR; Gopikrishna M; Sangal V; Devi ARR
J Hum Genet; 2004; 49(8):408-413. PubMed ID: 15278762
[TBL] [Abstract][Full Text] [Related]
4. Impact of beta globin gene mutations on the clinical phenotype of beta thalassemia in India.
Colah R; Nadkarni A; Gorakshakar A; Phanasgaonkar S; Surve R; Subramaniam PG; Bondge N; Pujari K; Ghosh K; Mohanty D
Blood Cells Mol Dis; 2004; 33(2):153-7. PubMed ID: 15315795
[TBL] [Abstract][Full Text] [Related]
5. Spectrum of beta-thalassemia mutations and their association with allelic sequence polymorphisms at the beta-globin gene cluster in an Eastern Indian population.
Kukreti R; Dash D; E VK; Chakravarty S; Das SK; De M; Talukder G
Am J Hematol; 2002 Aug; 70(4):269-77. PubMed ID: 12210807
[TBL] [Abstract][Full Text] [Related]
6. The spectrum of beta-thalassemia mutations in southern Thailand.
Nopparatana C; Panich V; Saechan V; Sriroongrueng V; Nopparatana C; Rungjeadpha J; Pornpatkul M; Laosombat V; Fukumaki Y
Southeast Asian J Trop Med Public Health; 1995; 26 Suppl 1():229-34. PubMed ID: 8629112
[TBL] [Abstract][Full Text] [Related]
7. Regional distribution of beta-thalassemia mutations in India.
Verma IC; Saxena R; Thomas E; Jain PK
Hum Genet; 1997 Jul; 100(1):109-13. PubMed ID: 9225979
[TBL] [Abstract][Full Text] [Related]
8. [A study on gene mutation spectrums of α- and β-thalassemias in populations of Yunnan Province and the prenatal gene diagnosis].
Zhu BS; He J; Zhang J; Zeng XH; Su J; Xu XH; Li SY; Chen H; Zhang YH
Zhonghua Fu Chan Ke Za Zhi; 2012 Feb; 47(2):85-9. PubMed ID: 22455737
[TBL] [Abstract][Full Text] [Related]
9. Geographic and ethnic distribution of beta-thalassemia mutations in Uttar Pradesh, India.
Agarwal S; Pradhan M; Gupta UR; Sarwai S; Agarwal SS
Hemoglobin; 2000 May; 24(2):89-97. PubMed ID: 10870879
[TBL] [Abstract][Full Text] [Related]
10. Molecular analysis of beta-thalassemia in South Vietnam.
Svasti S; Hieu TM; Munkongdee T; Winichagoon P; Van Be T; Van Binh T; Fucharoen S
Am J Hematol; 2002 Oct; 71(2):85-8. PubMed ID: 12353305
[TBL] [Abstract][Full Text] [Related]
11. Study of beta-Thalassemia mutations using the polymerase chain reaction-amplification refractory mutation system and direct DNA sequencing techniques in a group of Egyptian Thalassemia patients.
El-Gawhary S; El-Shafie S; Niazi M; Aziz M; El-Beshlawy A
Hemoglobin; 2007; 31(1):63-9. PubMed ID: 17365006
[TBL] [Abstract][Full Text] [Related]
12. Characterization of beta-thalassaemia mutations in 57 beta-thalassaemia families seen at Lucknow.
Agarwal S; Naveed M; Gupta UR; Kishore P; Agarwal SS
Indian J Med Res; 1994 Sep; 100():106-10. PubMed ID: 7959965
[TBL] [Abstract][Full Text] [Related]
13. β-Thalassemia mutations in Western India: outcome of prenatal diagnosis in a hemoglobinopathies project.
Patel AP; Patel RB; Patel SA; Vaniawala SN; Patel DS; Shrivastava NS; Sharma NP; Zala JV; Parmar PH; Naik MR
Hemoglobin; 2014; 38(5):329-34. PubMed ID: 25222044
[TBL] [Abstract][Full Text] [Related]
14. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.
Rizo-de-la-Torre LC; Ibarra B; Sánchez-López JY; Magaña-Torres MT; Rentería-López VM; Perea-Díaz FJ
Int J Lab Hematol; 2017 Oct; 39(5):539-545. PubMed ID: 28603845
[TBL] [Abstract][Full Text] [Related]
15. Prenatal diagnosis in beta-thalassemia: an Indian experience.
Agarwal S; Gupta A; Gupta UR; Sarwai S; Phadke S; Agarwal SS
Fetal Diagn Ther; 2003; 18(5):328-32. PubMed ID: 12913343
[TBL] [Abstract][Full Text] [Related]
16. The clinical severity of beta-thalassemia mutations in West Malaysia.
George E
Southeast Asian J Trop Med Public Health; 1995; 26 Suppl 1():225-8. PubMed ID: 8629111
[TBL] [Abstract][Full Text] [Related]
17. Spectrum of beta-globin gene mutations among thalassemia patients in the West Bank region of Palestine.
Darwish HM; El-Khatib FF; Ayesh S
Hemoglobin; 2005; 29(2):119-32. PubMed ID: 15921164
[TBL] [Abstract][Full Text] [Related]
18. Identification of two novel beta zero-thalassemia mutations in a Filipino family: frameshift codon 67 (-TG) and a beta-globin gene deletion.
Eng B; Chui DH; Saunderson J; Olivieri NF; Waye JS
Hum Mutat; 1993; 2(5):375-9. PubMed ID: 8257991
[TBL] [Abstract][Full Text] [Related]
19. Molecular heterogeneity of beta-thalassemia in Thailand.
Fukumaki Y; Fucharoen S; Fucharoen G; Okamoto N; Ichinose M; Jetsrisuparb A; Sriroongrueng W; Nopparatana C; Laosombat V; Panich V
Southeast Asian J Trop Med Public Health; 1992; 23 Suppl 2():14-21. PubMed ID: 1363706
[TBL] [Abstract][Full Text] [Related]
20. Spectrum of beta-thalassemia mutations in North Indian states: a beta-thalassemia trait with two mutations in cis.
Chakrabarti P; Gupta R; Mishra A; Rai M; Singh VP; Dash D
Clin Biochem; 2005 Jun; 38(6):576-8. PubMed ID: 15885239
[TBL] [Abstract][Full Text] [Related]
[Next] [New Search]
