These tools will no longer be maintained as of December 31, 2024. Archived website can be found here. PubMed4Hh GitHub repository can be found here. Contact NLM Customer Service if you have questions.


BIOMARKERS

Molecular Biopsy of Human Tumors

- a resource for Precision Medicine *

93 related articles for article (PubMed ID: 17259233)

  • 1. High-throughput microtiter well-based chemiluminometric genotyping of 15 HBB gene mutations in a dry-reagent format.
    Glynou K; Kastanis P; Boukouvala S; Tsaoussis V; Ioannou PC; Christopoulos TK; Traeger-Synodinos J; Kanavakis E
    Clin Chem; 2007 Mar; 53(3):384-91. PubMed ID: 17259233
    [TBL] [Abstract][Full Text] [Related]  

  • 2. Development of a universal chemiluminometric genotyping method for high-throughput detection of 7 LDLR gene mutations in Greek population.
    Glynou K; Laios E; Drogari E; Tsaoussis V
    Clin Biochem; 2008 Mar; 41(4-5):335-42. PubMed ID: 18206115
    [TBL] [Abstract][Full Text] [Related]  

  • 3. Rapid screening of multiple beta-globin gene mutations by real-time PCR on the LightCycler: application to carrier screening and prenatal diagnosis of thalassemia syndromes.
    Vrettou C; Traeger-Synodinos J; Tzetis M; Malamis G; Kanavakis E
    Clin Chem; 2003 May; 49(5):769-76. PubMed ID: 12709368
    [TBL] [Abstract][Full Text] [Related]  

  • 4. Lateral flow dipstick test for genotyping of 15 beta-globin gene (HBB) mutations with naked-eye detection.
    Papanikos F; Iliadi A; Petropoulou M; Ioannou PC; Christopoulos TK; Kanavakis E; Traeger-Synodinos J
    Anal Chim Acta; 2012 May; 727():61-6. PubMed ID: 22541824
    [TBL] [Abstract][Full Text] [Related]  

  • 5. High-throughput mutational screening for beta-thalassemia by single-nucleotide extension.
    Galbiati S; Chiari M; Macellari M; Ferrari M; Cremonesi L; Cretich M
    Electrophoresis; 2007 Dec; 28(23):4289-94. PubMed ID: 18040987
    [TBL] [Abstract][Full Text] [Related]  

  • 6. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.
    Rizo-de-la-Torre LC; Ibarra B; Sánchez-López JY; Magaña-Torres MT; Rentería-López VM; Perea-Díaz FJ
    Int J Lab Hematol; 2017 Oct; 39(5):539-545. PubMed ID: 28603845
    [TBL] [Abstract][Full Text] [Related]  

  • 7. Development of a new real-time PCR screening kit for HbS and common beta-thalassemia mutations observed in Turkey.
    Kan Karaer D; Ergün MA; Ruhi HI; Öztürk J; Kara H; Reisoğlu Çakmak D; Aydoğmuş T; Perçin EF
    Turk J Med Sci; 2017 Jun; 47(3):973-978. PubMed ID: 28618753
    [TBL] [Abstract][Full Text] [Related]  

  • 8. Ten Years of Routine α- and β-Globin Gene Sequencing in UK Hemoglobinopathy Referrals Reveals 60 Novel Mutations.
    Henderson SJ; Timbs AT; McCarthy J; Gallienne AE; Proven M; Rugless MJ; Lopez H; Eglinton J; Dziedzic D; Beardsall M; Khalil MS; Old JM
    Hemoglobin; 2016; 40(2):75-84. PubMed ID: 26635043
    [TBL] [Abstract][Full Text] [Related]  

  • 9. Accurate and rapid prenatal diagnosis of the most frequent East Mediterranean beta-thalassemia mutations.
    Naja RP; Kaspar H; Shbaklo H; Chakar N; Makhoul NJ; Zalloua PA
    Am J Hematol; 2004 Apr; 75(4):220-4. PubMed ID: 15054814
    [TBL] [Abstract][Full Text] [Related]  

  • 10. Detection of HBB:c.92+5G>C and HBB:c.108delC mutations in β-thalassemia carriers using high-resolution melting analysis.
    Hidayati NI; Wijayanti N; Handayani NSN
    Mol Biol Rep; 2020 Jul; 47(7):5665-5671. PubMed ID: 32638316
    [TBL] [Abstract][Full Text] [Related]  

  • 11. Evaluation of the BeTha gene 1 kit for the qualitative detection of the eight most common Mediterranean beta-thalassemia mutations.
    Ugozzoli LA; Lowery JD; Reyes AA; Lin CI; Re A; Locati F; Galanello R; Macioni L; Maggio A; Giambona A; Loutradi A; Boussiou M; Wallace RB
    Am J Hematol; 1998 Nov; 59(3):214-22. PubMed ID: 9798659
    [TBL] [Abstract][Full Text] [Related]  

  • 12. Beta-thalassemia microelectronic chip: a fast and accurate method for mutation detection.
    Foglieni B; Cremonesi L; Travi M; Ravani A; Giambona A; Rosatelli MC; Perra C; Fortina P; Ferrari M
    Clin Chem; 2004 Jan; 50(1):73-9. PubMed ID: 14709638
    [TBL] [Abstract][Full Text] [Related]  

  • 13. Multiplex Minisequencing of the HBB Gene: A Rapid Strategy to Confirm the Most Frequent β-Thalassemia Mutations in the Tunisian Population.
    Ben Charfeddine I; Ben Lazreg T; M'sakni A; Amara A; Mlika A; Chaïeb A; Hlel K; Zouari N; Zbidi F; Bouguila J; Soyah N; Ayedi A; Ben Hamouda H; Abroug S; Boughamoura L; Saad A; Gribaa M
    Hemoglobin; 2015; 39(4):251-5. PubMed ID: 26016902
    [TBL] [Abstract][Full Text] [Related]  

  • 14. Rapid detection of beta-globin gene (HBB) mutations coupling heteroduplex and primer-extension analysis by DHPLC.
    Su YN; Lee CN; Hung CC; Chen CA; Cheng WF; Tsao PN; Yu CL; Hsieh FJ
    Hum Mutat; 2003 Oct; 22(4):326-36. PubMed ID: 12955718
    [TBL] [Abstract][Full Text] [Related]  

  • 15. Molecular Characterization of β-Thalassemia Mutations Via the Amplification Refractory Mutation System-Polymerase Chain Reaction Method at the North Waziristan Agency, Pakistan.
    Khan NM; Rehman SU; Shakeel M; Khan S; Ahmed U; Rehman H; Yaseen T; Javid A
    Hemoglobin; 2018 Mar; 42(2):91-95. PubMed ID: 30200837
    [TBL] [Abstract][Full Text] [Related]  

  • 16. Experience with multiplex ARMS (MARMS)-PCR for the detection of common β-thalassemia mutations in India.
    Mahadik CT
    Cardiovasc Hematol Agents Med Chem; 2012 Mar; 10(1):14-24. PubMed ID: 22239493
    [TBL] [Abstract][Full Text] [Related]  

  • 17. Rapid, accurate genotyping of beta-thalassaemia mutations using a novel multiplex primer extension/denaturing high-performance liquid chromatography assay.
    Wu G; Hua L; Zhu J; Mo QH; Xu XM
    Br J Haematol; 2003 Jul; 122(2):311-6. PubMed ID: 12846902
    [TBL] [Abstract][Full Text] [Related]  

  • 18. The molecular characterization of Beta globin gene in thalassemia patients reveals rare and a novel mutations in Pakistani population.
    Yasmeen H; Toma S; Killeen N; Hasnain S; Foroni L
    Eur J Med Genet; 2016 Aug; 59(8):355-62. PubMed ID: 27263053
    [TBL] [Abstract][Full Text] [Related]  

  • 19. Simple, efficient, and cost-effective multiplex genotyping with matrix assisted laser desorption/ionization time-of-flight mass spectrometry of hemoglobin beta gene mutations.
    Thongnoppakhun W; Jiemsup S; Yongkiettrakul S; Kanjanakorn C; Limwongse C; Wilairat P; Vanasant A; Rungroj N; Yenchitsomanus PT
    J Mol Diagn; 2009 Jul; 11(4):334-46. PubMed ID: 19460936
    [TBL] [Abstract][Full Text] [Related]  

  • 20. Mutational Profile of Homozygous β-Thalassemia in Rio de Janeiro, Brazil.
    Carrocini GCS; Venancio LPR; Pessoa VLR; Lobo CLC; Bonini-Domingos CR
    Hemoglobin; 2017 Jan; 41(1):12-15. PubMed ID: 28366028
    [TBL] [Abstract][Full Text] [Related]  

    [Next]    [New Search]
    of 5.