120 related articles for article (PubMed ID: 21315703)
1. Multiplexed genotyping of beta globin mutations with MALDI-TOF mass spectrometry.
Looi ML; Sivalingam M; Husin ND; Radin FZ; Isa RM; Zakaria SZ; Hussin NH; Alias H; Latiff ZA; Ibrahim H; Jamal R
Clin Chim Acta; 2011 May; 412(11-12):999-1002. PubMed ID: 21315703
[TBL] [Abstract][Full Text] [Related]
2. Matrix-assisted laser desorption/ionization time-of-flight mass spectrometry for genotyping of human platelet-specific antigens.
Garritsen HS; Fan AX; Bosse N; Hannig H; Kelsch R; Kroll H; Holzgreve W; Zhong XY
Transfusion; 2009 Feb; 49(2):252-8. PubMed ID: 18980617
[TBL] [Abstract][Full Text] [Related]
3. Study of beta-Thalassemia mutations using the polymerase chain reaction-amplification refractory mutation system and direct DNA sequencing techniques in a group of Egyptian Thalassemia patients.
El-Gawhary S; El-Shafie S; Niazi M; Aziz M; El-Beshlawy A
Hemoglobin; 2007; 31(1):63-9. PubMed ID: 17365006
[TBL] [Abstract][Full Text] [Related]
4. Genotyping of β-globin gene mutations in single lymphocytes: a preliminary study for preimplantation genetic diagnosis of monogenic disorders.
Durmaz B; Ozkinay F; Onay H; Karaca E; Aydinok Y; Tavmergen E; Vrettou C; Traeger-Synodinos J; Kanavakis E
Hemoglobin; 2012; 36(3):230-43. PubMed ID: 22524255
[TBL] [Abstract][Full Text] [Related]
5. Rapid detection of six common Chinese G6PD mutations by MALDI-TOF MS.
Zhao F; Ou XL; Xu CC; Cai GQ; Wu XY; Huang YM; Zhu WF; Jiang QC
Blood Cells Mol Dis; 2004; 32(2):315-8. PubMed ID: 15003824
[TBL] [Abstract][Full Text] [Related]
6. Detection of beta-thalassemia mutations using a multiplex amplification refractory mutation system assay.
Mirasena S; Shimbhu D; Sanguansermsri M; Sanguansermsri T
Hemoglobin; 2008; 32(4):403-9. PubMed ID: 18654891
[TBL] [Abstract][Full Text] [Related]
7. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.
Rizo-de-la-Torre LC; Ibarra B; Sánchez-López JY; Magaña-Torres MT; Rentería-López VM; Perea-Díaz FJ
Int J Lab Hematol; 2017 Oct; 39(5):539-545. PubMed ID: 28603845
[TBL] [Abstract][Full Text] [Related]
8. A multiplex ARMS PCR approach to detection of common β-globin gene mutations.
Mishra KK; Patel P; Bhukhanvala DS; Shah A; Ghosh K
Anal Biochem; 2017 Nov; 537():93-98. PubMed ID: 28669707
[TBL] [Abstract][Full Text] [Related]
9. combination of IVS2.849 A-G witH IVS1.1 G-A: a mutation of beta-globin gene in a Turkish beta-thalessemia major patient.
Manguoğlu E; Sargin CF; Nal N; Keser I; Küpesiz A; Yeşilipek A; Lüleci G
Pediatr Hematol Oncol; 2005 Jun; 22(4):291-5. PubMed ID: 16020116
[TBL] [Abstract][Full Text] [Related]
10. Spectrum of beta-globin gene mutations among thalassemia patients in the West Bank region of Palestine.
Darwish HM; El-Khatib FF; Ayesh S
Hemoglobin; 2005; 29(2):119-32. PubMed ID: 15921164
[TBL] [Abstract][Full Text] [Related]
11. High-throughput multiplex SNP genotyping with MALDI-TOF mass spectrometry: practice, problems and promise.
Bray MS; Boerwinkle E; Doris PA
Hum Mutat; 2001 Apr; 17(4):296-304. PubMed ID: 11295828
[TBL] [Abstract][Full Text] [Related]
12. Simple, efficient, and cost-effective multiplex genotyping with matrix assisted laser desorption/ionization time-of-flight mass spectrometry of hemoglobin beta gene mutations.
Thongnoppakhun W; Jiemsup S; Yongkiettrakul S; Kanjanakorn C; Limwongse C; Wilairat P; Vanasant A; Rungroj N; Yenchitsomanus PT
J Mol Diagn; 2009 Jul; 11(4):334-46. PubMed ID: 19460936
[TBL] [Abstract][Full Text] [Related]
13. Identification of three novel mutations [-41 (A>C), codon 24 (-G), and IVS-I-109 (-T)], in a study of beta-thalassemia alleles in the Isfahan region of Iran.
Salehi R; Fisher CA; Bignell PA; Eslami G; Old JM
Hemoglobin; 2010; 34(1):115-20. PubMed ID: 20113296
[TBL] [Abstract][Full Text] [Related]
14. A new genotyping method for detecting low abundance single nucleotide mutations based on gap ligase chain reaction and quantitative PCR assay.
Yi P; Jiang H; Li L; Dai F; Zheng Y; Han J; Chen Z; Guo J
Cell Biochem Biophys; 2012 Jan; 62(1):161-7. PubMed ID: 22006255
[TBL] [Abstract][Full Text] [Related]
15. Molecular updating of β-thalassemia mutations in the Upper Egyptian population.
Jiffri EH; Bogari N; Zidan KH; Teama S; Elhawary NA
Hemoglobin; 2010; 34(6):538-47. PubMed ID: 21077761
[TBL] [Abstract][Full Text] [Related]
16. [Comparison study of HBV-P mutation detection by MALDI-TOF Ms and direct PCR sequencing].
Liu F; Xiao T; Wang L; Xie JP; Li GH; Liang QL; Luo CH
Zhonghua Gan Zang Bing Za Zhi; 2011 Jun; 19(6):436-9. PubMed ID: 22053374
[TBL] [Abstract][Full Text] [Related]
17. Molecular basis of β-thalassemia in the United Arab Emirates.
Baysal E
Hemoglobin; 2011; 35(5-6):581-8. PubMed ID: 22074124
[TBL] [Abstract][Full Text] [Related]
18. Rapid genotyping of known mutations and polymorphisms in beta-globin gene based on the DHPLC profile patterns of homoduplexes and heteroduplexes.
Li Q; Li LY; Huang SW; Li L; Chen XW; Zhou WJ; Xu XM
Clin Biochem; 2008 Jun; 41(9):681-7. PubMed ID: 18339318
[TBL] [Abstract][Full Text] [Related]
19. DNA analysis by MALDI-TOF mass spectrometry.
Gut IG
Hum Mutat; 2004 May; 23(5):437-41. PubMed ID: 15108274
[TBL] [Abstract][Full Text] [Related]
20. The clinical significance of the spectrum of interactions of CAP+1 (A-->C), a silent beta-globin gene mutation, with other beta-thalassemia mutations and globin gene modifiers in north Indians.
Garewal G; Das R; Awasthi A; Ahluwalia J; Marwaha RK
Eur J Haematol; 2007 Nov; 79(5):417-21. PubMed ID: 17900295
[TBL] [Abstract][Full Text] [Related]
[Next] [New Search]
