291 related articles for article (PubMed ID: 21797703)
1. Molecular analysis of β-thalassemia patients: first identification of mutations HBB:c.93-2A>G and HBB:c.114G>A in Brazil.
Fernandes AC; Shimmoto MM; Furuzawa GK; Vicari P; Figueiredo MS
Hemoglobin; 2011; 35(4):358-66. PubMed ID: 21797703
[TBL] [Abstract][Full Text] [Related]
2. Prevalence and molecular characterization of β-thalassemia in the state of Bahia, Brazil: first identification of mutation HBB: c.135delC in Brazil.
Fonseca SF; Moura Neto JP; Goncalves MS
Hemoglobin; 2013; 37(3):285-90. PubMed ID: 23425035
[TBL] [Abstract][Full Text] [Related]
3. Mutational Profile of Homozygous β-Thalassemia in Rio de Janeiro, Brazil.
Carrocini GCS; Venancio LPR; Pessoa VLR; Lobo CLC; Bonini-Domingos CR
Hemoglobin; 2017 Jan; 41(1):12-15. PubMed ID: 28366028
[TBL] [Abstract][Full Text] [Related]
4. The Spectrum of β-Thalassemia Mutations in a Population from the Brazilian Amazon.
Silva AN; Cardoso GL; Cunha DA; Diniz IG; Santos SE; Andrade GB; Trindade SM; Cardoso Mdo S; Francês LT; Guerreiro JF
Hemoglobin; 2016; 40(1):20-4. PubMed ID: 26372288
[TBL] [Abstract][Full Text] [Related]
5. The modifying effect of Xmn1-HBG2 on thalassemic phenotype is associated with its linked elements in the beta globin locus control region, including the palindromic site at 5'HS4.
Neishabury M; Zamani S; Azarkeivan A; Abedini SS; Darvish H; Zamani F; Najmabadi H
Blood Cells Mol Dis; 2012 Jan; 48(1):1-5. PubMed ID: 22036762
[TBL] [Abstract][Full Text] [Related]
6. β+-Thalassemia trait due to a novel mutation in the β-globin gene promoter: -26 (A>C) [HBB c.-76A>C].
Waye JS; Nakamura-Garrett LM; Eng B; Kanavakis E; Traeger-Synodinos J
Hemoglobin; 2011; 35(1):84-6. PubMed ID: 21250885
[TBL] [Abstract][Full Text] [Related]
7. Two novel mutations in the 3' untranslated region of the beta-globin gene that are associated with the mild phenotype of beta thalassemia.
Bilgen T; Clark OA; Ozturk Z; Akif Yesilipek M; Keser I
Int J Lab Hematol; 2013 Feb; 35(1):26-30. PubMed ID: 22862814
[TBL] [Abstract][Full Text] [Related]
8. Analyzing 5'HS3 and 5'HS4 LCR core regions and NF-E2 in Iranian thalassemia intermedia patients with normal or carrier status for beta-globin mutations.
Neishabury M; Azarkeivan A; Oberkanins C; Abedini SS; Zamani S; Najmabadi H
Blood Cells Mol Dis; 2011 Mar; 46(3):201-5. PubMed ID: 21232998
[TBL] [Abstract][Full Text] [Related]
9. Region-specific genetic heterogeneity of HBB mutation distribution in South-Western Greece.
Papachatzopoulou A; Kourakli A; Stavrou EF; Fragou E; Vantarakis A; Patrinos GP; Athanassiadou A
Hemoglobin; 2010; 34(4):333-42. PubMed ID: 20642331
[TBL] [Abstract][Full Text] [Related]
10. Spectrum of beta-thalassemia mutations and their association with allelic sequence polymorphisms at the beta-globin gene cluster in an Eastern Indian population.
Kukreti R; Dash D; E VK; Chakravarty S; Das SK; De M; Talukder G
Am J Hematol; 2002 Aug; 70(4):269-77. PubMed ID: 12210807
[TBL] [Abstract][Full Text] [Related]
11. Mutational spectrum of delta-globin gene in the Portuguese population.
Morgado A; Picanço I; Gomes S; Miranda A; Coucelo M; Seuanes F; Seixas MT; Romão L; Faustino P
Eur J Haematol; 2007 Nov; 79(5):422-8. PubMed ID: 17916081
[TBL] [Abstract][Full Text] [Related]
12. The molecular characterization of Beta globin gene in thalassemia patients reveals rare and a novel mutations in Pakistani population.
Yasmeen H; Toma S; Killeen N; Hasnain S; Foroni L
Eur J Med Genet; 2016 Aug; 59(8):355-62. PubMed ID: 27263053
[TBL] [Abstract][Full Text] [Related]
13. Analysis of beta-thalassemia mutations and beta-locus control region hypersensitive sites 2, 3 and 4 in southern Thailand.
Sriroongrueng W; Schleiemacher E; Panich V; Nopparatana C; Saechan V; Laosombat V; Pornpatkul M; Fukumaki Y
Southeast Asian J Trop Med Public Health; 1997; 28 Suppl 3():120-7. PubMed ID: 9640613
[TBL] [Abstract][Full Text] [Related]
14. Molecular update of β-thalassemia mutations in the Syrian population: identification of rare β-thalassemia mutations.
Jarjour RA; Murad H; Moasses F; Al-Achkar W
Hemoglobin; 2014; 38(4):272-6. PubMed ID: 24828949
[TBL] [Abstract][Full Text] [Related]
15. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.
Rizo-de-la-Torre LC; Ibarra B; Sánchez-López JY; Magaña-Torres MT; Rentería-López VM; Perea-Díaz FJ
Int J Lab Hematol; 2017 Oct; 39(5):539-545. PubMed ID: 28603845
[TBL] [Abstract][Full Text] [Related]
16. β-Thalassemia major resulting from compound heterozygosity for HBB: c.92+2T>C [formerly known as IVS-I-2 (T>C)] and a novel β(0)-thalassemia frameshift mutation: HBB: c.209delG; p.Gly70Valfs*20.
Kluge ML; Hoyer JD; Swanson KC; Oliveira JL
Hemoglobin; 2014; 38(4):292-4. PubMed ID: 24986053
[TBL] [Abstract][Full Text] [Related]
17. Clinical and haematological features in a compound heterozygote (HBB:c.92 + 5G > C/HBB:c.93-2A > C) case of thalassaemia major.
Agarwal S; Tamhankar PM; Kumar R; Dalal A
Int J Lab Hematol; 2010 Jun; 32(3):369-72. PubMed ID: 19486366
[TBL] [Abstract][Full Text] [Related]
18. Molecular spectrum of β-thalassemia mutations in the admixed Venezuelan population, and their linkage to β-globin gene haplotypes.
Bravo-Urquiola M; Arends A; Gómez G; Montilla S; Gerard N; Chacin M; Berbar T; García O; García G; Velasquez D; Castillo O; Krishnamoorthy R
Hemoglobin; 2012; 36(3):209-18. PubMed ID: 22563936
[TBL] [Abstract][Full Text] [Related]
19. A novel deletion/insertion caused by a replication error in the β-globin gene locus control region.
Joly P; Lacan P; Garcia C; Meley R; Pondarré C; Francina A
Hemoglobin; 2011; 35(4):316-22. PubMed ID: 21797698
[TBL] [Abstract][Full Text] [Related]
20. The clinical significance of the spectrum of interactions of CAP+1 (A-->C), a silent beta-globin gene mutation, with other beta-thalassemia mutations and globin gene modifiers in north Indians.
Garewal G; Das R; Awasthi A; Ahluwalia J; Marwaha RK
Eur J Haematol; 2007 Nov; 79(5):417-21. PubMed ID: 17900295
[TBL] [Abstract][Full Text] [Related]
[Next] [New Search]
