These tools will no longer be maintained as of December 31, 2024. Archived website can be found here. PubMed4Hh GitHub repository can be found here. Contact NLM Customer Service if you have questions.
132 related articles for article (PubMed ID: 22239493)
21. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients. Rizo-de-la-Torre LC; Ibarra B; Sánchez-López JY; Magaña-Torres MT; Rentería-López VM; Perea-Díaz FJ Int J Lab Hematol; 2017 Oct; 39(5):539-545. PubMed ID: 28603845 [TBL] [Abstract][Full Text] [Related]
22. Mutational Profile of Homozygous β-Thalassemia in Rio de Janeiro, Brazil. Carrocini GCS; Venancio LPR; Pessoa VLR; Lobo CLC; Bonini-Domingos CR Hemoglobin; 2017 Jan; 41(1):12-15. PubMed ID: 28366028 [TBL] [Abstract][Full Text] [Related]
23. Molecular characterisation of haemoglobin E-Udon Thani (HBB:c.[79G>A;92+7A>G]): a novel form of Hb E-β-thalassaemia syndrome. Singha K; Fucharoen G; Fucharoen S J Clin Pathol; 2019 Apr; 72(4):322-324. PubMed ID: 30630871 [TBL] [Abstract][Full Text] [Related]
24. Multiplex Minisequencing of the HBB Gene: A Rapid Strategy to Confirm the Most Frequent β-Thalassemia Mutations in the Tunisian Population. Ben Charfeddine I; Ben Lazreg T; M'sakni A; Amara A; Mlika A; Chaïeb A; Hlel K; Zouari N; Zbidi F; Bouguila J; Soyah N; Ayedi A; Ben Hamouda H; Abroug S; Boughamoura L; Saad A; Gribaa M Hemoglobin; 2015; 39(4):251-5. PubMed ID: 26016902 [TBL] [Abstract][Full Text] [Related]
25. Reliability of DHPLC in mutational screening of beta-globin (HBB) alleles. Colosimo A; Guida V; De Luca A; Cappabianca MP; Bianco I; Palka G; Dallapiccola B Hum Mutat; 2002 Mar; 19(3):287-95. PubMed ID: 11857746 [TBL] [Abstract][Full Text] [Related]
26. Comprehensive and efficient HBB mutation analysis for detection of beta-hemoglobinopathies in a pan-ethnic population. Chan OT; Westover KD; Dietz L; Zehnder JL; Schrijver I Am J Clin Pathol; 2010 May; 133(5):700-7. PubMed ID: 20395516 [TBL] [Abstract][Full Text] [Related]
27. Molecular genetic confirmatory testing from newborn screening samples for the common African-American, Asian Indian, Southeast Asian, and Chinese beta-thalassemia mutations. Bhardwaj U; Zhang YH; Lorey F; McCabe LL; McCabe ER Am J Hematol; 2005 Apr; 78(4):249-55. PubMed ID: 15795925 [TBL] [Abstract][Full Text] [Related]
28. β-Thalassemia major resulting from compound heterozygosity for HBB: c.92+2T>C [formerly known as IVS-I-2 (T>C)] and a novel β(0)-thalassemia frameshift mutation: HBB: c.209delG; p.Gly70Valfs*20. Kluge ML; Hoyer JD; Swanson KC; Oliveira JL Hemoglobin; 2014; 38(4):292-4. PubMed ID: 24986053 [TBL] [Abstract][Full Text] [Related]
29. Mutation analysis of the HBB gene in selected Bangladeshi beta-thalassemic individuals: presence of rare mutations. Ibn Ayub M; Moosa MM; Sarwardi G; Khan W; Khan H; Yeasmin S Genet Test Mol Biomarkers; 2010 Jun; 14(3):299-302. PubMed ID: 20406103 [TBL] [Abstract][Full Text] [Related]
30. Analysis of Common β-Thalassemia Mutations in North Vietnam. Vo LTT; Nguyen TT; Le HX; Le HTT Hemoglobin; 2018 Jan; 42(1):16-22. PubMed ID: 29493329 [TBL] [Abstract][Full Text] [Related]
31. Impact of beta globin gene mutations on the clinical phenotype of beta thalassemia in India. Colah R; Nadkarni A; Gorakshakar A; Phanasgaonkar S; Surve R; Subramaniam PG; Bondge N; Pujari K; Ghosh K; Mohanty D Blood Cells Mol Dis; 2004; 33(2):153-7. PubMed ID: 15315795 [TBL] [Abstract][Full Text] [Related]
32. Genotyping of beta thalassemia trait by high-resolution DNA melting analysis. Saetung R; Ongchai S; Charoenkwan P; Sanguansermsri T Southeast Asian J Trop Med Public Health; 2013 Nov; 44(6):1055-64. PubMed ID: 24450243 [TBL] [Abstract][Full Text] [Related]
33. Combine-ARMS: a rapid and cost-effective protocol for molecular characterization of beta-thalassemia in Malaysia. Tan KL; Tan JA; Wong YC; Wee YC; Thong MK; Yap SF Genet Test; 2001; 5(1):17-22. PubMed ID: 11336396 [TBL] [Abstract][Full Text] [Related]
34. A multi-center study in order to further define the molecular basis of beta-thalassemia in Thailand, Pakistan, Sri Lanka, Mauritius, Syria, and India, and to develop a simple molecular diagnostic strategy by amplification refractory mutation system-polymerase chain reaction. Old JM; Khan SN; Verma I; Fucharoen S; Kleanthous M; Ioannou P; Kotea N; Fisher C; Riazuddin S; Saxena R; Winichagoon P; Kyriacou K; Al-Quobaili F; Khan B Hemoglobin; 2001 Nov; 25(4):397-407. PubMed ID: 11791873 [TBL] [Abstract][Full Text] [Related]
35. Molecular basis of β-thalassemia in Karnataka, India. Kulkarni GD; Kulkarni SS; Kadakol GS; Kulkarni BB; Kyamangoudar PH; Lakkakula BV; Thangaraj K; Shepur TA; Kulkarni ML; Gai PB Genet Test Mol Biomarkers; 2012 Feb; 16(2):138-41. PubMed ID: 21978377 [TBL] [Abstract][Full Text] [Related]
36. Co-heredity of silent CAP + 1570 T>C (HBB:c*96T>C) defect and severe β-thal mutation: a cause of mild β-thalassemia intermedia. Vinciguerra M; Passarello C; Cassarà F; Leto F; Cannata M; Calvaruso G; Di Maggio R; Renda D; Maggio A; Giambona A Int J Lab Hematol; 2016 Feb; 38(1):17-26. PubMed ID: 26418075 [TBL] [Abstract][Full Text] [Related]
37. β-Thalassemia mutations in subjects with borderline HbA₂ values: a pilot study in North India. Rangan A; Sharma P; Dadu T; Saxena R; Verma IC; Bhargava M Clin Chem Lab Med; 2011 Sep; 49(12):2069-72. PubMed ID: 21892914 [TBL] [Abstract][Full Text] [Related]
38. Primer-introduced restriction analysis polymerase chain reaction method for non-invasive prenatal testing of β-thalassemia. Liu S; Chen L; Zhang X; Li J; Lin H; Liu L; Xie J; Ge H; Ye M; Chen C; Ji X; Zhang C; Xu F; Jiang H; Zhen H; Chen S; Wang W Hemoglobin; 2015; 39(1):18-23. PubMed ID: 25548039 [TBL] [Abstract][Full Text] [Related]
39. The Frequency of HBB Mutations Among β-Thalassemia Patients in Hamadan Province, Iran. Jalilian M; Azizi Jalilian F; Ahmadi L; Amini R; Esfehani H; Sosanian M; Rabbani B; Maleki M; Mahdieh N Hemoglobin; 2017 Jan; 41(1):61-64. PubMed ID: 28391758 [TBL] [Abstract][Full Text] [Related]
40. Distribution of beta-thalassemia mutations in the Indian population referred to a diagnostic center. Vaz FE; Thakur CB; Banerjee MK; Gangal SG Hemoglobin; 2000 Aug; 24(3):181-94. PubMed ID: 10975438 [TBL] [Abstract][Full Text] [Related] [Previous] [Next] [New Search]