These tools will no longer be maintained as of December 31, 2024. Archived website can be found here. PubMed4Hh GitHub repository can be found here. Contact NLM Customer Service if you have questions.


BIOMARKERS

Molecular Biopsy of Human Tumors

- a resource for Precision Medicine *

213 related articles for article (PubMed ID: 22392582)

  • 1. Prenatal screening for β-thalassemia major reveals new and rare mutations in the Pakistani population.
    Moatter T; Kausar T; Aban M; Ghani S; Pal JA
    Int J Hematol; 2012 Apr; 95(4):394-8. PubMed ID: 22392582
    [TBL] [Abstract][Full Text] [Related]  

  • 2. The molecular characterization of Beta globin gene in thalassemia patients reveals rare and a novel mutations in Pakistani population.
    Yasmeen H; Toma S; Killeen N; Hasnain S; Foroni L
    Eur J Med Genet; 2016 Aug; 59(8):355-62. PubMed ID: 27263053
    [TBL] [Abstract][Full Text] [Related]  

  • 3. Molecular Characterization of β-Thalassemia Mutations Via the Amplification Refractory Mutation System-Polymerase Chain Reaction Method at the North Waziristan Agency, Pakistan.
    Khan NM; Rehman SU; Shakeel M; Khan S; Ahmed U; Rehman H; Yaseen T; Javid A
    Hemoglobin; 2018 Mar; 42(2):91-95. PubMed ID: 30200837
    [TBL] [Abstract][Full Text] [Related]  

  • 4. Evaluation of the High Resolution Melting Approach for Detection of β-Thalassemia Gene Mutations.
    Tariq A; Khurshid S; Sajjad M
    Hemoglobin; 2021 Jan; 45(1):20-24. PubMed ID: 33602051
    [TBL] [Abstract][Full Text] [Related]  

  • 5. Genetic diversity of beta-thalassemia mutations in Pakistani population.
    Khateeb B; Moatter T; Shaghil AM; Haroon S; Kakepoto GN
    J Pak Med Assoc; 2000 Sep; 50(9):293-6. PubMed ID: 11043018
    [TBL] [Abstract][Full Text] [Related]  

  • 6. Molecular Heterogeneity of β-Thalassemia in the Kohat Region, Khyber Pakhtunkhwa Province, Pakistan.
    Naz S; Rehman SU; Shakeel M; Rehman H; Hussain M; Haider A
    Hemoglobin; 2020 Jan; 44(1):37-41. PubMed ID: 32079421
    [TBL] [Abstract][Full Text] [Related]  

  • 7. Molecular Characterization of β-Thalassemia Intermedia in Southeast Iran.
    Miri-Moghaddam E; Bahrami S; Naderi M; Bazi A; Karimipoor M
    Hemoglobin; 2016 Jun; 40(3):173-8. PubMed ID: 27117567
    [TBL] [Abstract][Full Text] [Related]  

  • 8. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.
    Rizo-de-la-Torre LC; Ibarra B; Sánchez-López JY; Magaña-Torres MT; Rentería-López VM; Perea-Díaz FJ
    Int J Lab Hematol; 2017 Oct; 39(5):539-545. PubMed ID: 28603845
    [TBL] [Abstract][Full Text] [Related]  

  • 9. Molecular genetic analyses of beta-thalassemia in South India reveals rare mutations in the beta-globin gene.
    Bashyam MD; Bashyam L; Savithri GR; Gopikrishna M; Sangal V; Devi ARR
    J Hum Genet; 2004; 49(8):408-413. PubMed ID: 15278762
    [TBL] [Abstract][Full Text] [Related]  

  • 10. The Spectrum of β-Thalassemia Mutations in Hamadan Province, West Iran.
    Alibakhshi R; Moradi K; Aznab M; Azimi A; Shafieenia S; Biglari M
    Hemoglobin; 2019 Jan; 43(1):18-22. PubMed ID: 31096791
    [TBL] [Abstract][Full Text] [Related]  

  • 11. Molecular genetics and prenatal diagnosis of beta thalassemia to control transfusion dependent births in carrier Pakistani couples.
    Kanwal S; Bukhari S; Perveen S
    J Pak Med Assoc; 2017 Jul; 67(7):1030-1034. PubMed ID: 28770881
    [TBL] [Abstract][Full Text] [Related]  

  • 12. Ten Years of Routine α- and β-Globin Gene Sequencing in UK Hemoglobinopathy Referrals Reveals 60 Novel Mutations.
    Henderson SJ; Timbs AT; McCarthy J; Gallienne AE; Proven M; Rugless MJ; Lopez H; Eglinton J; Dziedzic D; Beardsall M; Khalil MS; Old JM
    Hemoglobin; 2016; 40(2):75-84. PubMed ID: 26635043
    [TBL] [Abstract][Full Text] [Related]  

  • 13. β-Globin Gene Mutations in Pediatric Patients with β-Thalassemia in the Region of Çukurova, Turkey.
    Guzelgul F; Seydel GS; Aksoy K
    Hemoglobin; 2020 Jul; 44(4):249-253. PubMed ID: 32664780
    [TBL] [Abstract][Full Text] [Related]  

  • 14. Molecular Scanning of β-Thalassemia in the Southern Region of Central Java, Indonesia; a Step Towards a Local Prevention Program.
    Rujito L; Basalamah M; Mulatsih S; Sofro AS
    Hemoglobin; 2015; 39(5):330-3. PubMed ID: 26291967
    [TBL] [Abstract][Full Text] [Related]  

  • 15. Prenatal Diagnosis and Screening of Thalassemia Mutations in Bangladesh: Presence of Rare Mutations.
    Aziz MA; Khan WA; Banu B; Das SA; Sadiya S; Begum S
    Hemoglobin; 2020 Nov; 44(6):397-401. PubMed ID: 33092414
    [TBL] [Abstract][Full Text] [Related]  

  • 16. Distribution of
    Moradi K; Aznab M; Tahmasebi S; Omidniakan L; Bijari N; Alibakhshi R
    Hemoglobin; 2020 Jul; 44(4):244-248. PubMed ID: 32869674
    [TBL] [Abstract][Full Text] [Related]  

  • 17. The Spectrum of β-Thalassemia Mutations in Siirt Province, Southeastern Turkey.
    Yılmaz S
    Hemoglobin; 2019 May; 43(3):174-181. PubMed ID: 31411089
    [TBL] [Abstract][Full Text] [Related]  

  • 18. Population-Based Genetic Study of β-Thalassemia Mutations in Mardan Division, Khyber Pakhtunkhwa Province, Pakistan.
    Muhammad R; Shakeel M; Rehman SU; Lodhi MA
    Hemoglobin; 2017 Mar; 41(2):104-109. PubMed ID: 28635337
    [TBL] [Abstract][Full Text] [Related]  

  • 19. Molecular defects in the beta-globin gene identified in different ethnic groups/populations during prenatal diagnosis for beta-thalassemia: a Malaysian experience.
    Tan JA; George E; Tan KL; Chow T; Tan PC; Hassan J; Chia P; Subramanium R; Chandran R; Yap SF
    Clin Exp Med; 2004 Dec; 4(3):142-7. PubMed ID: 15599663
    [TBL] [Abstract][Full Text] [Related]  

  • 20. Genetic basis of ß-thalassemia in families of pashtun ethnicity in Dera Ismail Khan district of Khyber Pakhtun-Khwa province, Pakistan.
    Ayaz M; Muzammal M; Siraj S; Fatima S; Fatima S; Khan J; Khan MA; Shah MI; Rehman ZU; Wei L
    Expert Rev Hematol; 2023; 16(9):693-699. PubMed ID: 37491848
    [TBL] [Abstract][Full Text] [Related]  

    [Next]    [New Search]
    of 11.