145 related articles for article (PubMed ID: 26182339)
21. Three new beta-thalassemia mutations with varying degrees of severity.
Frischknecht H; Dutly F; Walker L; Nakamura-Garrett LM; Eng B; Waye JS
Hemoglobin; 2009; 33(3):220-5. PubMed ID: 19657836
[TBL] [Abstract][Full Text] [Related]
22. Identification of Two Novel β-Thalassemia Mutations (HBB: c.335-346del and HBB: c.108 C > G) in Han Chinese.
Wang W; Wang Q; Tao T; Sun A; Ruan C; Chen S
Hemoglobin; 2015; 39(5):359-61. PubMed ID: 26096710
[TBL] [Abstract][Full Text] [Related]
23. First Detection of the -27 (A > G) (HBB: c.-77A > G) Mutation of the β-Globin Gene in a Chinese Family.
Wu MY; Li DZ
Hemoglobin; 2016; 40(1):59-60. PubMed ID: 26554738
[TBL] [Abstract][Full Text] [Related]
24. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.
Rizo-de-la-Torre LC; Ibarra B; Sánchez-López JY; Magaña-Torres MT; Rentería-López VM; Perea-Díaz FJ
Int J Lab Hematol; 2017 Oct; 39(5):539-545. PubMed ID: 28603845
[TBL] [Abstract][Full Text] [Related]
25. IVS-II-16 (G>C) (
Uçucu S; Karabıyık T; Azik FM
Hemoglobin; 2021 Jul; 45(4):225-227. PubMed ID: 34396882
[TBL] [Abstract][Full Text] [Related]
26. Molecular Characterization of β-Thalassemia Intermedia in Southeast Iran.
Miri-Moghaddam E; Bahrami S; Naderi M; Bazi A; Karimipoor M
Hemoglobin; 2016 Jun; 40(3):173-8. PubMed ID: 27117567
[TBL] [Abstract][Full Text] [Related]
27. The Frequency of HBB Mutations Among β-Thalassemia Patients in Hamadan Province, Iran.
Jalilian M; Azizi Jalilian F; Ahmadi L; Amini R; Esfehani H; Sosanian M; Rabbani B; Maleki M; Mahdieh N
Hemoglobin; 2017 Jan; 41(1):61-64. PubMed ID: 28391758
[TBL] [Abstract][Full Text] [Related]
28. The Spectrum of β-Thalassemia Mutations in a Population from the Brazilian Amazon.
Silva AN; Cardoso GL; Cunha DA; Diniz IG; Santos SE; Andrade GB; Trindade SM; Cardoso Mdo S; Francês LT; Guerreiro JF
Hemoglobin; 2016; 40(1):20-4. PubMed ID: 26372288
[TBL] [Abstract][Full Text] [Related]
29. First detection of the splice donor site IVS-I-2 (T-->B) beta-thalassemia mutation in a Chinese patient.
Liao C; Li J; Huang Y; Li D
Haematologica; 2005 Dec; 90(12):1695. PubMed ID: 16330445
[TBL] [Abstract][Full Text] [Related]
30. Double Heterozygosity for Hb Durham-N.C. (
Cannata M; Cassarà F; Vinciguerra M; Licari P; Passarello C; Leto F; Lo Pinto C; Pitrolo L; Ganci R; Maggio A; Giambona A
Hemoglobin; 2019 May; 43(3):210-213. PubMed ID: 31456457
[TBL] [Abstract][Full Text] [Related]
31. Two novel mutations in the 3' untranslated region of the beta-globin gene that are associated with the mild phenotype of beta thalassemia.
Bilgen T; Clark OA; Ozturk Z; Akif Yesilipek M; Keser I
Int J Lab Hematol; 2013 Feb; 35(1):26-30. PubMed ID: 22862814
[TBL] [Abstract][Full Text] [Related]
32. Mutation analysis of the HBB gene in selected Bangladeshi beta-thalassemic individuals: presence of rare mutations.
Ibn Ayub M; Moosa MM; Sarwardi G; Khan W; Khan H; Yeasmin S
Genet Test Mol Biomarkers; 2010 Jun; 14(3):299-302. PubMed ID: 20406103
[TBL] [Abstract][Full Text] [Related]
33. β-Thalassemia gene mutations in Antalya, Turkey: results from a single centre study.
Kurtoğlu A; Karakuş V; Erkal Ö; Kurtoğlu E
Hemoglobin; 2016 Nov; 40(6):392-395. PubMed ID: 28276871
[TBL] [Abstract][Full Text] [Related]
34. β-Thalassemia Intermedia Associated with Heterozygous and Isolate β-Globin Gene Mutation [IVS-II-1 (HBB: c.315G>A)].
Poddighe D; Roncoroni L; Comi EV; Bruni P
Hemoglobin; 2015; 39(5):366-7. PubMed ID: 26193974
[TBL] [Abstract][Full Text] [Related]
35. Association between Different Polymorphic Markers and β-Thalassemia Intermedia in Central Iran.
Sajadpour Z; Amini-Farsani Z; Motovali-Bashi M; Yadollahi M; Khosravi-Farsani N
Hemoglobin; 2020 Jan; 44(1):27-30. PubMed ID: 31899996
[TBL] [Abstract][Full Text] [Related]
36. Molecular update of β-thalassemia mutations in the Syrian population: identification of rare β-thalassemia mutations.
Jarjour RA; Murad H; Moasses F; Al-Achkar W
Hemoglobin; 2014; 38(4):272-6. PubMed ID: 24828949
[TBL] [Abstract][Full Text] [Related]
37. Identification of a Novel β-Globin Mutation (HBB: C.189_195delTCATGGC) in a Chinese Family.
He S; Lin L; Wei Y; Chen B; Yi S; Chen Q; Qiu X; Wei H; Li G; Zheng C
Hemoglobin; 2016 Aug; 40(4):277-9. PubMed ID: 27492766
[TBL] [Abstract][Full Text] [Related]
38. Ten Years of Routine α- and β-Globin Gene Sequencing in UK Hemoglobinopathy Referrals Reveals 60 Novel Mutations.
Henderson SJ; Timbs AT; McCarthy J; Gallienne AE; Proven M; Rugless MJ; Lopez H; Eglinton J; Dziedzic D; Beardsall M; Khalil MS; Old JM
Hemoglobin; 2016; 40(2):75-84. PubMed ID: 26635043
[TBL] [Abstract][Full Text] [Related]
39. Phenotypic expression and origin of the rare beta-thalassemia splice site mutation HBB:c.315 + 1G>T.
Broquere C; Brudey K; Harteveld CL; Saint-Martin C; Elion J; Giordano PC; Romana M
Hemoglobin; 2010 Jun; 34(3):322-6. PubMed ID: 20524821
[TBL] [Abstract][Full Text] [Related]
40. Co-heredity of silent CAP + 1570 T>C (HBB:c*96T>C) defect and severe β-thal mutation: a cause of mild β-thalassemia intermedia.
Vinciguerra M; Passarello C; Cassarà F; Leto F; Cannata M; Calvaruso G; Di Maggio R; Renda D; Maggio A; Giambona A
Int J Lab Hematol; 2016 Feb; 38(1):17-26. PubMed ID: 26418075
[TBL] [Abstract][Full Text] [Related]
[Previous] [Next] [New Search]
