224 related articles for article (PubMed ID: 26201722)
21. Primer-introduced restriction analysis polymerase chain reaction method for non-invasive prenatal testing of β-thalassemia.
Liu S; Chen L; Zhang X; Li J; Lin H; Liu L; Xie J; Ge H; Ye M; Chen C; Ji X; Zhang C; Xu F; Jiang H; Zhen H; Chen S; Wang W
Hemoglobin; 2015; 39(1):18-23. PubMed ID: 25548039
[TBL] [Abstract][Full Text] [Related]
22. [A study on gene mutation spectrums of α- and β-thalassemias in populations of Yunnan Province and the prenatal gene diagnosis].
Zhu BS; He J; Zhang J; Zeng XH; Su J; Xu XH; Li SY; Chen H; Zhang YH
Zhonghua Fu Chan Ke Za Zhi; 2012 Feb; 47(2):85-9. PubMed ID: 22455737
[TBL] [Abstract][Full Text] [Related]
23. Prenatal screening for β-thalassemia major reveals new and rare mutations in the Pakistani population.
Moatter T; Kausar T; Aban M; Ghani S; Pal JA
Int J Hematol; 2012 Apr; 95(4):394-8. PubMed ID: 22392582
[TBL] [Abstract][Full Text] [Related]
24. Next generation sequencing of SNPs for non-invasive prenatal diagnosis: challenges and feasibility as illustrated by an application to β-thalassaemia.
Papasavva T; van Ijcken WF; Kockx CE; van den Hout MC; Kountouris P; Kythreotis L; Kalogirou E; Grosveld FG; Kleanthous M
Eur J Hum Genet; 2013 Dec; 21(12):1403-10. PubMed ID: 23572027
[TBL] [Abstract][Full Text] [Related]
25. Non-invasive prenatal screening & diagnosis of β-thalassaemia in an affected foetus.
Suwannakhon N; Hemvuthiphan J; Pangeson T; Mahingsa K; Pingyod A; Bumrungpakdee W; Sanguansermsri T
Indian J Med Res; 2023 May; 157(5):447-452. PubMed ID: 37322635
[TBL] [Abstract][Full Text] [Related]
26. Noninvasive prenatal testing of beta-thalassemia for common Pakistani mutations: a comparative study using cell-free fetal DNA from maternal plasma and chorionic villus sampling.
Afzal M; Naeem MA; Ahmed S; Amin N; Rahim A; Munawar M; Ishaq M; Rathore A; Maria K
Hematology; 2022 Dec; 27(1):353-359. PubMed ID: 35287566
[TBL] [Abstract][Full Text] [Related]
27. Size fractionation of cell-free DNA in maternal plasma and its application in noninvasive detection of fetal single gene point mutations.
Li Y; Holzgreve W; Hahn S
Methods Mol Biol; 2008; 444():239-51. PubMed ID: 18425486
[TBL] [Abstract][Full Text] [Related]
28. Non-invasive prenatal testing of beta-hemoglobinopathies using next generation sequencing, in-silico sequence size selection, and haplotyping.
Erlich HA; Ko L; Lee J; Eaton K; Calloway CD; Lal A; Das R; Jamwal M; Lopez-Pena C; Mack SJ
Croat Med J; 2024 Jun; 65(3):180-188. PubMed ID: 38868964
[TBL] [Abstract][Full Text] [Related]
29. Noninvasive prenatal diagnosis experience in the Çukurova Region of Southern Turkey: detecting paternal mutations of sickle cell anemia and β-thalassemia in cell-free fetal DNA using high-resolution melting analysis.
Yenilmez ED; Tuli A; Evrüke IC
Prenat Diagn; 2013 Nov; 33(11):1054-62. PubMed ID: 23836351
[TBL] [Abstract][Full Text] [Related]
30. Identification of a novel beta O-thalassaemia mutation in a Greek family and subsequent prenatal diagnosis.
Waye JS; Eng B; Olivieri NF; Chui DH
Prenat Diagn; 1994 Oct; 14(10):929-32. PubMed ID: 7899267
[TBL] [Abstract][Full Text] [Related]
31. Analysis of cosegregation of intragenic DNA sequence variations as markers of maternal cell contamination in prenatal diagnosis of β-thalassemia.
Saadi AV; Girisha KM; Gopinath PM; Satyamoorthy K
Transl Res; 2011 Mar; 157(3):150-5. PubMed ID: 21316031
[TBL] [Abstract][Full Text] [Related]
32. Noninvasive prenatal diagnosis of monogenic diseases by targeted massively parallel sequencing of maternal plasma: application to β-thalassemia.
Lam KW; Jiang P; Liao GJ; Chan KC; Leung TY; Chiu RW; Lo YM
Clin Chem; 2012 Oct; 58(10):1467-75. PubMed ID: 22896714
[TBL] [Abstract][Full Text] [Related]
33. Haplotypes inside the beta-globin gene: use as new biomarkers for beta-thalassemia prenatal diagnosis in north of Iran.
Hashemi-Soteh MB; Mousavi SS; Tafazoli A
J Biomed Sci; 2017 Dec; 24(1):92. PubMed ID: 29202846
[TBL] [Abstract][Full Text] [Related]
34. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.
Rizo-de-la-Torre LC; Ibarra B; Sánchez-López JY; Magaña-Torres MT; Rentería-López VM; Perea-Díaz FJ
Int J Lab Hematol; 2017 Oct; 39(5):539-545. PubMed ID: 28603845
[TBL] [Abstract][Full Text] [Related]
35. [Cell-free fetal DNA detection in maternal plasma using real-time PCR and cycling probe technology for prenatal screening beta-thalassaemia major].
Chen X; Ren JH; Guo H; Lin LH; Yao QX
Nan Fang Yi Ke Da Xue Xue Bao; 2008 Jul; 28(7):1210-3. PubMed ID: 18676265
[TBL] [Abstract][Full Text] [Related]
36. [Prenatal diagnosis of β-thalassaemia using cell-free fetal DNA in maternal plasma].
Li GH; Rong KB; Luo YF; Chen D; Gong CP; Wu J; DI YW; Ge YF
Nan Fang Yi Ke Da Xue Xue Bao; 2011 Aug; 31(8):1437-9. PubMed ID: 21868341
[TBL] [Abstract][Full Text] [Related]
37. [Non-invasive prenatal genetic diagnosis of beta-thalassaemia using single fetal nucleated erythrocyte from maternal blood].
Wei HY; Long G; Lin WX; Li SQ
Zhonghua Er Ke Za Zhi; 2007 Dec; 45(12):917-21. PubMed ID: 18339280
[TBL] [Abstract][Full Text] [Related]
38. Arrayed primer extension for the noninvasive prenatal diagnosis of beta-thalassemia based on detection of single nucleotide polymorphisms.
Papasavva T; Kalikas I; Kyrri A; Kleanthous M
Ann N Y Acad Sci; 2008 Aug; 1137():302-8. PubMed ID: 18837964
[TBL] [Abstract][Full Text] [Related]
39. Single cell detection of beta-thalassaemia mutations using silver stained SSCP analysis: an application for preimplantation diagnosis.
el-Hashemite N; Wells D; Delhanty JD
Mol Hum Reprod; 1997 Aug; 3(8):693-8. PubMed ID: 9294853
[TBL] [Abstract][Full Text] [Related]
40. Noninvasive prenatal diagnosis of beta-thalassaemia using individual fetal erythroblasts isolated from maternal blood after enrichment.
Kolialexi A; Vrettou C; Traeger-Synodinos J; Burgemeister R; Papantoniou N; Kanavakis E; Antsaklis A; Mavrou A
Prenat Diagn; 2007 Dec; 27(13):1228-32. PubMed ID: 17987605
[TBL] [Abstract][Full Text] [Related]
[Previous] [Next] [New Search]
