These tools will no longer be maintained as of December 31, 2024. Archived website can be found here. PubMed4Hh GitHub repository can be found here. Contact NLM Customer Service if you have questions.


BIOMARKERS

Molecular Biopsy of Human Tumors

- a resource for Precision Medicine *

245 related articles for article (PubMed ID: 26290442)

  • 21. β-Thalassemia major resulting from compound heterozygosity for HBB: c.92+2T>C [formerly known as IVS-I-2 (T>C)] and a novel β(0)-thalassemia frameshift mutation: HBB: c.209delG; p.Gly70Valfs*20.
    Kluge ML; Hoyer JD; Swanson KC; Oliveira JL
    Hemoglobin; 2014; 38(4):292-4. PubMed ID: 24986053
    [TBL] [Abstract][Full Text] [Related]  

  • 22. Identification of Two Novel β-Thalassemia Mutations (HBB: c.335-346del and HBB: c.108 C > G) in Han Chinese.
    Wang W; Wang Q; Tao T; Sun A; Ruan C; Chen S
    Hemoglobin; 2015; 39(5):359-61. PubMed ID: 26096710
    [TBL] [Abstract][Full Text] [Related]  

  • 23. A second observation of the rare frameshift mutation in the β-globin gene: codon 46 (+A) (Hbb:c.138_139insA).
    Ghedira ES; Dupin-Deguine D; Duffilot D; Lemetayer N; Faubert E; Pissard S
    Hemoglobin; 2011; 35(2):157-61. PubMed ID: 21417574
    [TBL] [Abstract][Full Text] [Related]  

  • 24. Molecular Basis of β-Thalassemia Intermedia in Erbil Province of Iraqi Kurdistan.
    Shamoon RP; Al-Allawi NA; Cappellini MD; Di Pierro E; Brancaleoni V; Granata F
    Hemoglobin; 2015; 39(3):178-83. PubMed ID: 25902180
    [TBL] [Abstract][Full Text] [Related]  

  • 25. A novel β(0)-thalassemia frameshift mutation: [HBB:c.216delT].
    Konialis C; Hagnefelt B; Sevastidou S; Pispili K; Pangalos C
    Hemoglobin; 2012; 36(6):586-8. PubMed ID: 23106651
    [TBL] [Abstract][Full Text] [Related]  

  • 26. Association between Different Polymorphic Markers and β-Thalassemia Intermedia in Central Iran.
    Sajadpour Z; Amini-Farsani Z; Motovali-Bashi M; Yadollahi M; Khosravi-Farsani N
    Hemoglobin; 2020 Jan; 44(1):27-30. PubMed ID: 31899996
    [TBL] [Abstract][Full Text] [Related]  

  • 27. A novel 26 bp deletion [HBB: c.20_45del26bp] in exon 1 of the β-globin gene causing β-thalassemia major.
    Edison ES; Venkatesan RS; Govindanattar SD; George B; Shaji RV
    Hemoglobin; 2012; 36(1):98-102. PubMed ID: 22233277
    [TBL] [Abstract][Full Text] [Related]  

  • 28. Molecular update of β-thalassemia mutations in the Syrian population: identification of rare β-thalassemia mutations.
    Jarjour RA; Murad H; Moasses F; Al-Achkar W
    Hemoglobin; 2014; 38(4):272-6. PubMed ID: 24828949
    [TBL] [Abstract][Full Text] [Related]  

  • 29. A Clinical Update of the Hb Siirt [β27(B9)Ala→Gly; HBB: c.83C>G] Hemoglobin Variant.
    Cappabianca MP; Colosimo A; Sabatucci A; Dainese E; Di Biagio P; Piscitelli R; Sarra O; Zei D; Amato A
    Hemoglobin; 2017 Jan; 41(1):53-55. PubMed ID: 28391745
    [TBL] [Abstract][Full Text] [Related]  

  • 30. The Effect of Nonsense Mediated Decay on Transcriptional Activity Within the Novel β-Thalassemia Mutation HBB: c.129delT.
    Forster L; Ardakani RM; Qadah T; Finlayson J; Ghassemifar R
    Hemoglobin; 2015; 39(5):334-9. PubMed ID: 26207313
    [TBL] [Abstract][Full Text] [Related]  

  • 31. First Report of a Dominantly Inherited β-Thalassemia Caused by a Novel Elongated β-Globin Chain.
    Farashi S; Rad F; Shahmohammadi B; Imanian H; Azarkeivan A; Najmabadi H
    Hemoglobin; 2016; 40(2):102-7. PubMed ID: 26850598
    [TBL] [Abstract][Full Text] [Related]  

  • 32. Hb Wilde and Hb Patagonia: two novel elongated beta-globin variants causing dominant beta-thalassemia.
    Scheps KG; Hasenahuer MA; Parisi G; Fornasari MS; Pennesi SP; Erramouspe B; Basack FN; Veber ES; Aversa L; Elena G; Varela V
    Eur J Haematol; 2015 Jun; 94(6):498-503. PubMed ID: 25284604
    [TBL] [Abstract][Full Text] [Related]  

  • 33. Double Heterozygosity for Hb Durham-N.C. (
    Cannata M; Cassarà F; Vinciguerra M; Licari P; Passarello C; Leto F; Lo Pinto C; Pitrolo L; Ganci R; Maggio A; Giambona A
    Hemoglobin; 2019 May; 43(3):210-213. PubMed ID: 31456457
    [TBL] [Abstract][Full Text] [Related]  

  • 34. Nonsense β-thalassemia mutation at codon 37 (TGG>TGA), detected for the first time in three Turkish cases.
    Bozdogan ST; Unsal C; Erkman H; Genc A; Yuregir OO; Muslumanoglu MH; Aslan H
    Hemoglobin; 2012; 36(3):283-8. PubMed ID: 22385009
    [TBL] [Abstract][Full Text] [Related]  

  • 35. Detection of a rare mutation in an Iranian family: codons 37/38/39 (7 bp deletion).
    Zadeh-Vakili A; Eshghi P
    Hemoglobin; 2009; 33(6):523-7. PubMed ID: 19958201
    [TBL] [Abstract][Full Text] [Related]  

  • 36. Two novel mutations in the 3' untranslated region of the beta-globin gene that are associated with the mild phenotype of beta thalassemia.
    Bilgen T; Clark OA; Ozturk Z; Akif Yesilipek M; Keser I
    Int J Lab Hematol; 2013 Feb; 35(1):26-30. PubMed ID: 22862814
    [TBL] [Abstract][Full Text] [Related]  

  • 37. First Detection of a Splice Site β-Thalassemia Mutation, IVS-I-6 (T > C) (HBB: c.92 + 6T > C) in a Chinese Family.
    Chen B; Huang P; Yi S; Chen Q; Tang Y; Zhang Q; He S
    Hemoglobin; 2015; 39(3):207-8. PubMed ID: 25856402
    [TBL] [Abstract][Full Text] [Related]  

  • 38. The Spectrum of β-Thalassemia Mutations in a Population from the Brazilian Amazon.
    Silva AN; Cardoso GL; Cunha DA; Diniz IG; Santos SE; Andrade GB; Trindade SM; Cardoso Mdo S; Francês LT; Guerreiro JF
    Hemoglobin; 2016; 40(1):20-4. PubMed ID: 26372288
    [TBL] [Abstract][Full Text] [Related]  

  • 39. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.
    Rizo-de-la-Torre LC; Ibarra B; Sánchez-López JY; Magaña-Torres MT; Rentería-López VM; Perea-Díaz FJ
    Int J Lab Hematol; 2017 Oct; 39(5):539-545. PubMed ID: 28603845
    [TBL] [Abstract][Full Text] [Related]  

  • 40. First Description of a β-Thalassemia Mutation, -86 (C > G) (HBB: c.-136C > G), in a Chinese Family.
    He S; Qin Q; Yi S; Zhou W; Deng J; Zheng C; Chen B
    Hemoglobin; 2015; 39(6):448-50. PubMed ID: 26291972
    [TBL] [Abstract][Full Text] [Related]  

    [Previous]   [Next]    [New Search]
    of 13.