These tools will no longer be maintained as of December 31, 2024. Archived website can be found here. PubMed4Hh GitHub repository can be found here. Contact NLM Customer Service if you have questions.


BIOMARKERS

Molecular Biopsy of Human Tumors

- a resource for Precision Medicine *

439 related articles for article (PubMed ID: 26372288)

  • 1. The Spectrum of β-Thalassemia Mutations in a Population from the Brazilian Amazon.
    Silva AN; Cardoso GL; Cunha DA; Diniz IG; Santos SE; Andrade GB; Trindade SM; Cardoso Mdo S; Francês LT; Guerreiro JF
    Hemoglobin; 2016; 40(1):20-4. PubMed ID: 26372288
    [TBL] [Abstract][Full Text] [Related]  

  • 2. Mutational Profile of Homozygous β-Thalassemia in Rio de Janeiro, Brazil.
    Carrocini GCS; Venancio LPR; Pessoa VLR; Lobo CLC; Bonini-Domingos CR
    Hemoglobin; 2017 Jan; 41(1):12-15. PubMed ID: 28366028
    [TBL] [Abstract][Full Text] [Related]  

  • 3. Prevalence and molecular characterization of β-thalassemia in the state of Bahia, Brazil: first identification of mutation HBB: c.135delC in Brazil.
    Fonseca SF; Moura Neto JP; Goncalves MS
    Hemoglobin; 2013; 37(3):285-90. PubMed ID: 23425035
    [TBL] [Abstract][Full Text] [Related]  

  • 4. Molecular Characterization of β-Thalassemia Intermedia in Southeast Iran.
    Miri-Moghaddam E; Bahrami S; Naderi M; Bazi A; Karimipoor M
    Hemoglobin; 2016 Jun; 40(3):173-8. PubMed ID: 27117567
    [TBL] [Abstract][Full Text] [Related]  

  • 5. β-Thalassemia Haplotypes in Romania in the Context of Genetic Mixing in the Mediterranean Area.
    Cherry L; Calo C; Talmaci R; Perrin P; Gavrila L
    Hemoglobin; 2016; 40(2):85-96. PubMed ID: 26711012
    [TBL] [Abstract][Full Text] [Related]  

  • 6. Hb S/
    Belisário AR; Carneiro-Proietti AB; Sabino EC; Araújo A; Loureiro P; Máximo C; Flor-Park MV; Rodrigues DDOW; Ozahata MC; McClure C; Mota RA; Gomes Moura IC; Custer B; Kelly S;
    Hemoglobin; 2020 Jan; 44(1):1-9. PubMed ID: 32172616
    [TBL] [Abstract][Full Text] [Related]  

  • 7. Ten Years of Routine α- and β-Globin Gene Sequencing in UK Hemoglobinopathy Referrals Reveals 60 Novel Mutations.
    Henderson SJ; Timbs AT; McCarthy J; Gallienne AE; Proven M; Rugless MJ; Lopez H; Eglinton J; Dziedzic D; Beardsall M; Khalil MS; Old JM
    Hemoglobin; 2016; 40(2):75-84. PubMed ID: 26635043
    [TBL] [Abstract][Full Text] [Related]  

  • 8. Molecular Scanning of β-Thalassemia in the Southern Region of Central Java, Indonesia; a Step Towards a Local Prevention Program.
    Rujito L; Basalamah M; Mulatsih S; Sofro AS
    Hemoglobin; 2015; 39(5):330-3. PubMed ID: 26291967
    [TBL] [Abstract][Full Text] [Related]  

  • 9. β-Globin Gene Mutations in Pediatric Patients with β-Thalassemia in the Region of Çukurova, Turkey.
    Guzelgul F; Seydel GS; Aksoy K
    Hemoglobin; 2020 Jul; 44(4):249-253. PubMed ID: 32664780
    [TBL] [Abstract][Full Text] [Related]  

  • 10. The Spectrum of β-Thalassemia Mutations in Hamadan Province, West Iran.
    Alibakhshi R; Moradi K; Aznab M; Azimi A; Shafieenia S; Biglari M
    Hemoglobin; 2019 Jan; 43(1):18-22. PubMed ID: 31096791
    [TBL] [Abstract][Full Text] [Related]  

  • 11. Molecular analysis of β-thalassemia patients: first identification of mutations HBB:c.93-2A>G and HBB:c.114G>A in Brazil.
    Fernandes AC; Shimmoto MM; Furuzawa GK; Vicari P; Figueiredo MS
    Hemoglobin; 2011; 35(4):358-66. PubMed ID: 21797703
    [TBL] [Abstract][Full Text] [Related]  

  • 12. The Spectrum of β-Thalassemia Mutations in the Population Migration in Lebanon: A 6-Year Retrospective Study.
    Farra C; Abdouni L; Souaid M; Awwad J; Yazbeck N; Abboud M
    Hemoglobin; 2021 Nov; 45(6):365-370. PubMed ID: 33947296
    [TBL] [Abstract][Full Text] [Related]  

  • 13. Multiplex Minisequencing of the HBB Gene: A Rapid Strategy to Confirm the Most Frequent β-Thalassemia Mutations in the Tunisian Population.
    Ben Charfeddine I; Ben Lazreg T; M'sakni A; Amara A; Mlika A; Chaïeb A; Hlel K; Zouari N; Zbidi F; Bouguila J; Soyah N; Ayedi A; Ben Hamouda H; Abroug S; Boughamoura L; Saad A; Gribaa M
    Hemoglobin; 2015; 39(4):251-5. PubMed ID: 26016902
    [TBL] [Abstract][Full Text] [Related]  

  • 14. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.
    Rizo-de-la-Torre LC; Ibarra B; Sánchez-López JY; Magaña-Torres MT; Rentería-López VM; Perea-Díaz FJ
    Int J Lab Hematol; 2017 Oct; 39(5):539-545. PubMed ID: 28603845
    [TBL] [Abstract][Full Text] [Related]  

  • 15. Molecular update of β-thalassemia mutations in the Syrian population: identification of rare β-thalassemia mutations.
    Jarjour RA; Murad H; Moasses F; Al-Achkar W
    Hemoglobin; 2014; 38(4):272-6. PubMed ID: 24828949
    [TBL] [Abstract][Full Text] [Related]  

  • 16. The Spectrum of β-Thalassemia Mutations in Siirt Province, Southeastern Turkey.
    Yılmaz S
    Hemoglobin; 2019 May; 43(3):174-181. PubMed ID: 31411089
    [TBL] [Abstract][Full Text] [Related]  

  • 17. β-Thalassemia gene mutations in Antalya, Turkey: results from a single centre study.
    Kurtoğlu A; Karakuş V; Erkal Ö; Kurtoğlu E
    Hemoglobin; 2016 Nov; 40(6):392-395. PubMed ID: 28276871
    [TBL] [Abstract][Full Text] [Related]  

  • 18. The Frequency of HBB Mutations Among β-Thalassemia Patients in Hamadan Province, Iran.
    Jalilian M; Azizi Jalilian F; Ahmadi L; Amini R; Esfehani H; Sosanian M; Rabbani B; Maleki M; Mahdieh N
    Hemoglobin; 2017 Jan; 41(1):61-64. PubMed ID: 28391758
    [TBL] [Abstract][Full Text] [Related]  

  • 19. Updated Molecular Spectrum of β-Thalassemia Mutations in Duhok Province, Northern Iraq: Ethnic Variation and the Impact of Immigration.
    Atroshi SD; Al-Allawi NAS; Eissa AA
    Hemoglobin; 2021 Jul; 45(4):239-244. PubMed ID: 34794358
    [TBL] [Abstract][Full Text] [Related]  

  • 20. Region-specific genetic heterogeneity of HBB mutation distribution in South-Western Greece.
    Papachatzopoulou A; Kourakli A; Stavrou EF; Fragou E; Vantarakis A; Patrinos GP; Athanassiadou A
    Hemoglobin; 2010; 34(4):333-42. PubMed ID: 20642331
    [TBL] [Abstract][Full Text] [Related]  

    [Next]    [New Search]
    of 22.