176 related articles for article (PubMed ID: 27339814)
1. Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha(0) -thalassemia deletions - -(Mex1) and - -(Mex2).
de-la-Cruz-Salcedo EI; Ibarra B; Rizo-de-la-Torre LC; Sánchez-López JY; González-Mercado A; Harteveld CL; Perea-Díaz FJ
Int J Lab Hematol; 2016 Oct; 38(5):535-42. PubMed ID: 27339814
[TBL] [Abstract][Full Text] [Related]
2. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.
Rizo-de-la-Torre LC; Ibarra B; Sánchez-López JY; Magaña-Torres MT; Rentería-López VM; Perea-Díaz FJ
Int J Lab Hematol; 2017 Oct; 39(5):539-545. PubMed ID: 28603845
[TBL] [Abstract][Full Text] [Related]
3. Molecular and Hematological Analysis of Alpha- and Beta-Thalassemia in a Cohort of Mexican Patients.
Rizo-de la Torre LDC; Rentería-López VM; Sánchez-López JY; Magaña-Torres MT; Ibarra-Cortés B; Perea-Díaz FJ
Genet Test Mol Biomarkers; 2021 Mar; 25(3):247-252. PubMed ID: 33734896
[No Abstract] [Full Text] [Related]
4. Evaluation of Alpha-Thalassemia Mutations in Cases with Hypochromic Microcytic Anemia: The İstanbul Perspective.
Karakaş Z; Koç B; Temurhan S; Elgün T; Karaman S; Asker G; Gençay G; Timur Ç; Yıldırmak ZY; Celkan T; Devecioğlu Ö; Aydın F
Turk J Haematol; 2015 Dec; 32(4):344-50. PubMed ID: 26377141
[TBL] [Abstract][Full Text] [Related]
5. Ten Years of Routine α- and β-Globin Gene Sequencing in UK Hemoglobinopathy Referrals Reveals 60 Novel Mutations.
Henderson SJ; Timbs AT; McCarthy J; Gallienne AE; Proven M; Rugless MJ; Lopez H; Eglinton J; Dziedzic D; Beardsall M; Khalil MS; Old JM
Hemoglobin; 2016; 40(2):75-84. PubMed ID: 26635043
[TBL] [Abstract][Full Text] [Related]
6. Molecular spectrum of beta-thalassemia in the Mexican population.
Perea FJ; Magaña MT; Cobián JG; Sánchez-López JY; Chávez ML; Zamudio G; Esparza MA; López-Guido B; Ibarra B
Blood Cells Mol Dis; 2004; 33(2):150-2. PubMed ID: 15315794
[TBL] [Abstract][Full Text] [Related]
7. Association of Hb A
Panyasai S; Pornprasert S
Hemoglobin; 2020 May; 44(3):179-183. PubMed ID: 32482156
[TBL] [Abstract][Full Text] [Related]
8. Mild Thalassemia Intermedia Due to Interaction of δβ-Thalassemia with Triplicated α-Globin Genes.
Payán-Pernía S; Bernal Noguera S; Rojas Rodríguez E; Serra Ferrer M; Remacha Sevilla ÁF
Hemoglobin; 2020 Jul; 44(4):294-296. PubMed ID: 32693657
[TBL] [Abstract][Full Text] [Related]
9. A Novel 31.1 kb α-Thalassemia Deletion (- -
Rentería-López VM; Perea-Díaz FJ; Rizo-delaTorre LC; Sánchez-López JY; Ibarra-Cortés B
Hemoglobin; 2017 May; 41(3):180-184. PubMed ID: 28791910
[TBL] [Abstract][Full Text] [Related]
10. α-Thalassemia Intermedia Results from Interactions of Unstable Hb Prato [α31(B12)Arg→Ser (
Panyasai S; Phasit A
Hemoglobin; 2020 Jul; 44(4):264-271. PubMed ID: 32727229
[TBL] [Abstract][Full Text] [Related]
11. Identification of Mutations Causing Aberrant Termination and Deficient Splice Donor Site on the HBA1 Gene.
Farashi S; Vakili S; Garous NF; Ashki M; Forouzesh Pour F; Zeinali F; Rad F; Imanian H; Azarkeivan A; Najmabadi H
Hemoglobin; 2016; 40(1):38-43. PubMed ID: 26531168
[TBL] [Abstract][Full Text] [Related]
12. Molecular characterization of alpha-thalassemia in the Mexican population.
Reyes-Núñez V; Garcés-Eisele J; Jorge S; Kimura E; Ferreira-Costa F; Sonati Mde F; Ruiz-Reyes G
Rev Invest Clin; 2006; 58(3):234-6. PubMed ID: 16958299
[TBL] [Abstract][Full Text] [Related]
13. Molecular Study of Deletional and Nondeletional Mutations on the α-Globin Locus in the Azeri Population of Northwestern Iran.
Derakhshan SM; Khaniani MS; Afkhami F; PourFeizi AH
Hemoglobin; 2016 Sep; 40(5):319-322. PubMed ID: 27690152
[TBL] [Abstract][Full Text] [Related]
14. Nondeletional α-Thalassemia: Two New Mutations on the α2 Gene.
Ropero P; Arbeteta J; Nieto JM; González FA; González B; Villegas A; Benavente C
Hemoglobin; 2020 Jan; 44(1):17-19. PubMed ID: 32000548
[TBL] [Abstract][Full Text] [Related]
15. Hb Milano [α109(G16)Leu→Pro (C
Curcio C; Giannone V; Benzoni E; Cesaretti C; Ivaldi G
Hemoglobin; 2019 Jan; 43(1):4-6. PubMed ID: 31084368
[TBL] [Abstract][Full Text] [Related]
16. Hb Knossos (HBB: c.82G > T), β-globin CD 5 (-CT) (HBB: c.17_18delCT) and δ-globin CD 59 (-a) (HBD: c.179delA) mutations in a Syrian patient with β-thalassemia intermedia.
Moassas F; Nweder MS; Murad H
BMC Pediatr; 2019 Feb; 19(1):61. PubMed ID: 30777047
[TBL] [Abstract][Full Text] [Related]
17. A novel α(0) -thalassemia deletion in a Greek patient with HbH disease and β-thalassemia trait.
Phylipsen M; Traeger-Synodinos J; van der Kraan M; van Delft P; Bakker G; Geerts M; Kanavakis E; Stamoulakatou A; Karagiorga M; Giordano PC; Harteveld CL
Eur J Haematol; 2012 Apr; 88(4):356-62. PubMed ID: 22324317
[TBL] [Abstract][Full Text] [Related]
18. Diagnosis and molecular characterization of a novel α
Makis A; Georgiou I; Traeger-Synodinos J; Chaliasos N; Grosso M; Gambale A; Iolascon A
Int J Lab Hematol; 2017 Oct; 39(5):e124-e126. PubMed ID: 28603861
[No Abstract] [Full Text] [Related]
19. Combined Gap-Polymerase Chain Reaction and Targeted Next-Generation Sequencing Improve α- and β-Thalassemia Carrier Screening in Pregnant Women in Vietnam.
Lam TT; Nguyen DT; Le QT; Nguyen DA; Hoang DT; Nguyen HD; Nguyen CC; Doan KPT; Tran NT; Ha TMT; Trinh THN; Nguyen VT; Lam DT; Le MT; Nguyen XT; Ho TT; Tran TH; Ho VT; Bui TV; Nguyen VT; Hoang PB; Nguyen HT; Nguyen MH; Vo TB; Le DN; Truong TN; Dao HT; Vo PN; Nguyen TV; Tran NT; Tran QT; Van YT; Nguyen TT; Huynh BT; Nguyen TT; Tran KT; Nguyen CT; Doan PL; Nguyen TD; Do TT; Truong DK; Tang HS; Cao NT; Phan MD; Giang H; Nguyen HN
Hemoglobin; 2022 Jul; 46(4):233-239. PubMed ID: 35993587
[TBL] [Abstract][Full Text] [Related]
20. Molecular Characterization of β-Thalassemia Intermedia in Southeast Iran.
Miri-Moghaddam E; Bahrami S; Naderi M; Bazi A; Karimipoor M
Hemoglobin; 2016 Jun; 40(3):173-8. PubMed ID: 27117567
[TBL] [Abstract][Full Text] [Related]
[Next] [New Search]
