314 related articles for article (PubMed ID: 28603845)
1. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.
Rizo-de-la-Torre LC; Ibarra B; Sánchez-López JY; Magaña-Torres MT; Rentería-López VM; Perea-Díaz FJ
Int J Lab Hematol; 2017 Oct; 39(5):539-545. PubMed ID: 28603845
[TBL] [Abstract][Full Text] [Related]
2. Molecular Scanning of β-Thalassemia in the Southern Region of Central Java, Indonesia; a Step Towards a Local Prevention Program.
Rujito L; Basalamah M; Mulatsih S; Sofro AS
Hemoglobin; 2015; 39(5):330-3. PubMed ID: 26291967
[TBL] [Abstract][Full Text] [Related]
3. Mutational Profile of Homozygous β-Thalassemia in Rio de Janeiro, Brazil.
Carrocini GCS; Venancio LPR; Pessoa VLR; Lobo CLC; Bonini-Domingos CR
Hemoglobin; 2017 Jan; 41(1):12-15. PubMed ID: 28366028
[TBL] [Abstract][Full Text] [Related]
4. Molecular spectrum of beta-thalassemia in the Mexican population.
Perea FJ; Magaña MT; Cobián JG; Sánchez-López JY; Chávez ML; Zamudio G; Esparza MA; López-Guido B; Ibarra B
Blood Cells Mol Dis; 2004; 33(2):150-2. PubMed ID: 15315794
[TBL] [Abstract][Full Text] [Related]
5. Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha(0) -thalassemia deletions - -(Mex1) and - -(Mex2).
de-la-Cruz-Salcedo EI; Ibarra B; Rizo-de-la-Torre LC; Sánchez-López JY; González-Mercado A; Harteveld CL; Perea-Díaz FJ
Int J Lab Hematol; 2016 Oct; 38(5):535-42. PubMed ID: 27339814
[TBL] [Abstract][Full Text] [Related]
6. Ten Years of Routine α- and β-Globin Gene Sequencing in UK Hemoglobinopathy Referrals Reveals 60 Novel Mutations.
Henderson SJ; Timbs AT; McCarthy J; Gallienne AE; Proven M; Rugless MJ; Lopez H; Eglinton J; Dziedzic D; Beardsall M; Khalil MS; Old JM
Hemoglobin; 2016; 40(2):75-84. PubMed ID: 26635043
[TBL] [Abstract][Full Text] [Related]
7. The Spectrum of β-Thalassemia Mutations in a Population from the Brazilian Amazon.
Silva AN; Cardoso GL; Cunha DA; Diniz IG; Santos SE; Andrade GB; Trindade SM; Cardoso Mdo S; Francês LT; Guerreiro JF
Hemoglobin; 2016; 40(1):20-4. PubMed ID: 26372288
[TBL] [Abstract][Full Text] [Related]
8. Molecular basis of β-thalassemia in the western province of Saudi Arabia: identification of rare β-thalassemia mutations.
Abuzenadah AM; Hussein IM; Damanhouri GA; A-Sayes FM; Gari MA; Chaudhary AG; Zaher GF; Al-Attas A; Al-Qahtani MH
Hemoglobin; 2011; 35(4):346-57. PubMed ID: 21797702
[TBL] [Abstract][Full Text] [Related]
9. Molecular Characterization of β-Thalassemia Intermedia in Southeast Iran.
Miri-Moghaddam E; Bahrami S; Naderi M; Bazi A; Karimipoor M
Hemoglobin; 2016 Jun; 40(3):173-8. PubMed ID: 27117567
[TBL] [Abstract][Full Text] [Related]
10. The Spectrum of β-Thalassemia Mutations in Hamadan Province, West Iran.
Alibakhshi R; Moradi K; Aznab M; Azimi A; Shafieenia S; Biglari M
Hemoglobin; 2019 Jan; 43(1):18-22. PubMed ID: 31096791
[TBL] [Abstract][Full Text] [Related]
11. The molecular characterization of Beta globin gene in thalassemia patients reveals rare and a novel mutations in Pakistani population.
Yasmeen H; Toma S; Killeen N; Hasnain S; Foroni L
Eur J Med Genet; 2016 Aug; 59(8):355-62. PubMed ID: 27263053
[TBL] [Abstract][Full Text] [Related]
12. β-Globin Gene Mutations in Pediatric Patients with β-Thalassemia in the Region of Çukurova, Turkey.
Guzelgul F; Seydel GS; Aksoy K
Hemoglobin; 2020 Jul; 44(4):249-253. PubMed ID: 32664780
[TBL] [Abstract][Full Text] [Related]
13. Molecular spectrum of β-thalassemia mutations in the admixed Venezuelan population, and their linkage to β-globin gene haplotypes.
Bravo-Urquiola M; Arends A; Gómez G; Montilla S; Gerard N; Chacin M; Berbar T; García O; García G; Velasquez D; Castillo O; Krishnamoorthy R
Hemoglobin; 2012; 36(3):209-18. PubMed ID: 22563936
[TBL] [Abstract][Full Text] [Related]
14. Beta-thalassemia and beta[A] globin gene haplotypes in Mexican mestizos.
Villalobos-Arámbula AR; Bustos R; Casas-Castañeda M; Gutiérrez E; Perea FJ; Thein SL; Ibarra B
Hum Genet; 1997 Apr; 99(4):498-500. PubMed ID: 9099840
[TBL] [Abstract][Full Text] [Related]
15. The Frequency of HBB Mutations Among β-Thalassemia Patients in Hamadan Province, Iran.
Jalilian M; Azizi Jalilian F; Ahmadi L; Amini R; Esfehani H; Sosanian M; Rabbani B; Maleki M; Mahdieh N
Hemoglobin; 2017 Jan; 41(1):61-64. PubMed ID: 28391758
[TBL] [Abstract][Full Text] [Related]
16. β-Thalassemia gene mutations in Antalya, Turkey: results from a single centre study.
Kurtoğlu A; Karakuş V; Erkal Ö; Kurtoğlu E
Hemoglobin; 2016 Nov; 40(6):392-395. PubMed ID: 28276871
[TBL] [Abstract][Full Text] [Related]
17. Molecular and Hematological Analysis of Alpha- and Beta-Thalassemia in a Cohort of Mexican Patients.
Rizo-de la Torre LDC; Rentería-López VM; Sánchez-López JY; Magaña-Torres MT; Ibarra-Cortés B; Perea-Díaz FJ
Genet Test Mol Biomarkers; 2021 Mar; 25(3):247-252. PubMed ID: 33734896
[No Abstract] [Full Text] [Related]
18. Molecular Basis of β-Thalassemia in the Population of the Aegean Region of Turkey: Identification of A Novel Deletion Mutation.
Ozkinay F; Onay H; Karaca E; Arslan E; Erturk B; Ece Solmaz A; Tekin IM; Cogulu O; Aydinok Y; Vergin C
Hemoglobin; 2015; 39(4):230-4. PubMed ID: 26076395
[TBL] [Abstract][Full Text] [Related]
19. The Spectrum of β-Thalassemia Mutations in the Population Migration in Lebanon: A 6-Year Retrospective Study.
Farra C; Abdouni L; Souaid M; Awwad J; Yazbeck N; Abboud M
Hemoglobin; 2021 Nov; 45(6):365-370. PubMed ID: 33947296
[TBL] [Abstract][Full Text] [Related]
20. Molecular analysis of β-thalassemia patients: first identification of mutations HBB:c.93-2A>G and HBB:c.114G>A in Brazil.
Fernandes AC; Shimmoto MM; Furuzawa GK; Vicari P; Figueiredo MS
Hemoglobin; 2011; 35(4):358-66. PubMed ID: 21797703
[TBL] [Abstract][Full Text] [Related]
[Next] [New Search]
