These tools will no longer be maintained as of December 31, 2024. Archived website can be found here. PubMed4Hh GitHub repository can be found here. Contact NLM Customer Service if you have questions.
224 related articles for article (PubMed ID: 28669707)
21. [Molecular epidemiological analysis of α- and β-thalassemia in Fujian province]. Xu LP; Huang HL; Wang Y; Zheng L; Wang LS; Xu JB; Huang XX; Lin Y Zhonghua Yi Xue Yi Chuan Xue Za Zhi; 2013 Aug; 30(4):403-6. PubMed ID: 23926004 [TBL] [Abstract][Full Text] [Related]
22. Prevalence and Distribution of Major β-Thalassemia Mutations and HbE/β-Thalassemia Variant in Nepalese Ethnic Groups. Lama R; Yusof W; Shrestha TR; Hanafi S; Bhattarai M; Hassan R; Zilfalil BA Hematol Oncol Stem Cell Ther; 2022 Mar; 15(1):279-284. PubMed ID: 33592169 [TBL] [Abstract][Full Text] [Related]
23. Rapid, accurate genotyping of beta-thalassaemia mutations using a novel multiplex primer extension/denaturing high-performance liquid chromatography assay. Wu G; Hua L; Zhu J; Mo QH; Xu XM Br J Haematol; 2003 Jul; 122(2):311-6. PubMed ID: 12846902 [TBL] [Abstract][Full Text] [Related]
24. Molecular Scanning of β-Thalassemia in the Southern Region of Central Java, Indonesia; a Step Towards a Local Prevention Program. Rujito L; Basalamah M; Mulatsih S; Sofro AS Hemoglobin; 2015; 39(5):330-3. PubMed ID: 26291967 [TBL] [Abstract][Full Text] [Related]
25. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients. Rizo-de-la-Torre LC; Ibarra B; Sánchez-López JY; Magaña-Torres MT; Rentería-López VM; Perea-Díaz FJ Int J Lab Hematol; 2017 Oct; 39(5):539-545. PubMed ID: 28603845 [TBL] [Abstract][Full Text] [Related]
26. Molecular analysis of beta-thalassemia in South Vietnam. Svasti S; Hieu TM; Munkongdee T; Winichagoon P; Van Be T; Van Binh T; Fucharoen S Am J Hematol; 2002 Oct; 71(2):85-8. PubMed ID: 12353305 [TBL] [Abstract][Full Text] [Related]
27. Rapid identification of common β-thalassemia mutations in the Chinese population using duplex or triplex amplicon genotyping by high-resolution melting analysis. He X; Sheng M; Xu M; Xiong C; Ren Z Genet Test Mol Biomarkers; 2010 Dec; 14(6):851-6. PubMed ID: 21034280 [TBL] [Abstract][Full Text] [Related]
28. The use of the amplification refractory mutation system (arms) in the detection of rare beta-thalassemia mutations in the Malays and Chinese in Malaysia. Chan Yoke Fan ; Tan Kim Lian ; Wong Yean Ching ; Wee Yong Chui ; Yap Sook Fan ; Tan Jin Ai Mary Anne Southeast Asian J Trop Med Public Health; 2001 Dec; 32(4):872-9. PubMed ID: 12041567 [TBL] [Abstract][Full Text] [Related]
29. Molecular updating of β-thalassemia mutations in the Upper Egyptian population. Jiffri EH; Bogari N; Zidan KH; Teama S; Elhawary NA Hemoglobin; 2010; 34(6):538-47. PubMed ID: 21077761 [TBL] [Abstract][Full Text] [Related]
30. Molecular genetic confirmatory testing from newborn screening samples for the common African-American, Asian Indian, Southeast Asian, and Chinese beta-thalassemia mutations. Bhardwaj U; Zhang YH; Lorey F; McCabe LL; McCabe ER Am J Hematol; 2005 Apr; 78(4):249-55. PubMed ID: 15795925 [TBL] [Abstract][Full Text] [Related]
31. The spectrum of β-thalassemia mutations in Baghdad, Central Iraq. Al-Allawi NA; Al-Mousawi BM; Badi AI; Jalal SD Hemoglobin; 2013; 37(5):444-53. PubMed ID: 23826747 [TBL] [Abstract][Full Text] [Related]
32. Sudanese (δβ)0-Thalassemia: Identification and Characterization of a Novel 9.6 kb Deletion. Waye JS; Eng B; Got T; Hanna M; Hohenadel BA; Nakamura LM; Walker L Hemoglobin; 2015; 39(5):368-70. PubMed ID: 26154945 [TBL] [Abstract][Full Text] [Related]
33. Genotyping of β-globin gene mutations in single lymphocytes: a preliminary study for preimplantation genetic diagnosis of monogenic disorders. Durmaz B; Ozkinay F; Onay H; Karaca E; Aydinok Y; Tavmergen E; Vrettou C; Traeger-Synodinos J; Kanavakis E Hemoglobin; 2012; 36(3):230-43. PubMed ID: 22524255 [TBL] [Abstract][Full Text] [Related]
34. Sickle cell disease in the Kurdish population of northern Iraq. Al-Allawi NA; Jalal SD; Nerwey FF; Al-Sayan GO; Al-Zebari SS; Alshingaly AA; Markous RD; Jubrael JM; Hamamy H Hemoglobin; 2012; 36(4):333-42. PubMed ID: 22686351 [TBL] [Abstract][Full Text] [Related]
35. Molecular basis of β-thalassemia in the United Arab Emirates. Baysal E Hemoglobin; 2011; 35(5-6):581-8. PubMed ID: 22074124 [TBL] [Abstract][Full Text] [Related]
36. The molecular analysis of beta-thalassemia mutations in Lorestan Province, Iran. Kiani AA; Mortazavi Y; Zeinali S; Shirkhani Y Hemoglobin; 2007; 31(3):343-9. PubMed ID: 17654071 [TBL] [Abstract][Full Text] [Related]
37. Detection of β-globin Gene Mutations Among β-thalassaemia Carriers and Patients in Malaysia: Application of Multiplex Amplification Refractory Mutation System-Polymerase Chain Reaction. Hassan S; Ahmad R; Zakaria Z; Zulkafli Z; Abdullah WZ Malays J Med Sci; 2013 Jan; 20(1):13-20. PubMed ID: 23613656 [TBL] [Abstract][Full Text] [Related]
38. Molecular analysis of beta-globin gene mutations among Thai beta-thalassemia children: results from a single center study. Boonyawat B; Monsereenusorn C; Traivaree C Appl Clin Genet; 2014; 7():253-8. PubMed ID: 25525381 [TBL] [Abstract][Full Text] [Related]
39. Distribution of beta-thalassemia mutations in the Indian population referred to a diagnostic center. Vaz FE; Thakur CB; Banerjee MK; Gangal SG Hemoglobin; 2000 Aug; 24(3):181-94. PubMed ID: 10975438 [TBL] [Abstract][Full Text] [Related]
40. Primer-introduced restriction analysis polymerase chain reaction method for non-invasive prenatal testing of β-thalassemia. Liu S; Chen L; Zhang X; Li J; Lin H; Liu L; Xie J; Ge H; Ye M; Chen C; Ji X; Zhang C; Xu F; Jiang H; Zhen H; Chen S; Wang W Hemoglobin; 2015; 39(1):18-23. PubMed ID: 25548039 [TBL] [Abstract][Full Text] [Related] [Previous] [Next] [New Search]