169 related articles for article (PubMed ID: 32703054)
21. Mild β(+)-thalassemia associated with two linked sequence variants: IVS-II-839 (T>C) and IVS-II-844 (C>A).
Waye JS; Eng B; Hellens L; Hohenadel BA; Nakamura LM; Walker L
Hemoglobin; 2013; 37(4):378-86. PubMed ID: 23651435
[TBL] [Abstract][Full Text] [Related]
22. Description of a rare β-globin gene mutation, IVS-II-848 (C>A) (
Shoujaa A; Mukhalalaty Y; Murad H; Al-Quobaili F
Hemoglobin; 2019; 43(4-5):283-285. PubMed ID: 31718331
[TBL] [Abstract][Full Text] [Related]
23. β-Thalassemia mutations found during 1 year of prenatal diagnoses in Fars Province, Iran.
Rahiminejad MS; Zeinali S; Afrasiabi A; Valeshabad AK
Hemoglobin; 2011; 35(4):331-7. PubMed ID: 21797700
[TBL] [Abstract][Full Text] [Related]
24. Molecular Characterization of β-Thalassemia Intermedia in Southeast Iran.
Miri-Moghaddam E; Bahrami S; Naderi M; Bazi A; Karimipoor M
Hemoglobin; 2016 Jun; 40(3):173-8. PubMed ID: 27117567
[TBL] [Abstract][Full Text] [Related]
25. COLD-PCR and microarray: two independent highly sensitive approaches allowing the identification of fetal paternally inherited mutations in maternal plasma.
Galbiati S; Monguzzi A; Damin F; Soriani N; Passiu M; Castellani C; Natacci F; Curcio C; Seia M; Lalatta F; Chiari M; Ferrari M; Cremonesi L
J Med Genet; 2016 Jul; 53(7):481-7. PubMed ID: 26912453
[TBL] [Abstract][Full Text] [Related]
26. Prenatal molecular diagnosis of β-thalassemia and sickle cell anemia in the Syrian population.
Murad H; Moassas F; Jarjour R; Mukhalalaty Y; Al-Achkar W
Hemoglobin; 2014; 38(6):390-3. PubMed ID: 25405916
[TBL] [Abstract][Full Text] [Related]
27. First Detection of a Splice Acceptor Site β-Thalassemia Mutation: IVS-I-130 (HBB: c.93-1G > C) in a Chinese Patient.
He S; Zhang Q; Zheng C; Wei Y; Tang Y; Chen Q; Chen S
Hemoglobin; 2015; 39(4):290-1. PubMed ID: 26182339
[TBL] [Abstract][Full Text] [Related]
28. Profile of β-thalassemia and its prenatal diagnosis in Khorasan-e-Jonobi Province, Iran.
Miri-Moghaddam E; Zadeh-Vakili A
Hemoglobin; 2012; 36(5):456-63. PubMed ID: 22920564
[TBL] [Abstract][Full Text] [Related]
29. [A study on gene mutation spectrums of α- and β-thalassemias in populations of Yunnan Province and the prenatal gene diagnosis].
Zhu BS; He J; Zhang J; Zeng XH; Su J; Xu XH; Li SY; Chen H; Zhang YH
Zhonghua Fu Chan Ke Za Zhi; 2012 Feb; 47(2):85-9. PubMed ID: 22455737
[TBL] [Abstract][Full Text] [Related]
30. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.
Rizo-de-la-Torre LC; Ibarra B; Sánchez-López JY; Magaña-Torres MT; Rentería-López VM; Perea-Díaz FJ
Int J Lab Hematol; 2017 Oct; 39(5):539-545. PubMed ID: 28603845
[TBL] [Abstract][Full Text] [Related]
31. Updated Molecular Spectrum of β-Thalassemia Mutations in Duhok Province, Northern Iraq: Ethnic Variation and the Impact of Immigration.
Atroshi SD; Al-Allawi NAS; Eissa AA
Hemoglobin; 2021 Jul; 45(4):239-244. PubMed ID: 34794358
[TBL] [Abstract][Full Text] [Related]
32. Identification of three novel mutations [-41 (A>C), codon 24 (-G), and IVS-I-109 (-T)], in a study of beta-thalassemia alleles in the Isfahan region of Iran.
Salehi R; Fisher CA; Bignell PA; Eslami G; Old JM
Hemoglobin; 2010; 34(1):115-20. PubMed ID: 20113296
[TBL] [Abstract][Full Text] [Related]
33. Investigation of sensitivity, specificity and accuracy of Tetra primer ARMS PCR method in comparison with conventional ARMS PCR, based on sequencing technique outcomes in IVS-II-I genotyping of beta thalassemia patients.
Honardoost MA; Tabatabaeian H; Akbari M; Salehi M
Gene; 2014 Oct; 549(1):1-6. PubMed ID: 24946023
[TBL] [Abstract][Full Text] [Related]
34. IVS-II-648/649 (-T) (HBB: c.316-202del) Triggers a Novel β-Thalassemia Phenotype.
Azimi A; Alibakhshi R; Hayati H; Tahmasebi S; Alimoradi S
Hemoglobin; 2017 Jan; 41(1):44-46. PubMed ID: 28475449
[TBL] [Abstract][Full Text] [Related]
35. Noninvasive prenatal diagnosis experience in the Çukurova Region of Southern Turkey: detecting paternal mutations of sickle cell anemia and β-thalassemia in cell-free fetal DNA using high-resolution melting analysis.
Yenilmez ED; Tuli A; Evrüke IC
Prenat Diagn; 2013 Nov; 33(11):1054-62. PubMed ID: 23836351
[TBL] [Abstract][Full Text] [Related]
36. Molecular spectrum of β-thalassemia mutations in the admixed Venezuelan population, and their linkage to β-globin gene haplotypes.
Bravo-Urquiola M; Arends A; Gómez G; Montilla S; Gerard N; Chacin M; Berbar T; García O; García G; Velasquez D; Castillo O; Krishnamoorthy R
Hemoglobin; 2012; 36(3):209-18. PubMed ID: 22563936
[TBL] [Abstract][Full Text] [Related]
37. First Detection of a Splice Site β-Thalassemia Mutation, IVS-I-6 (T > C) (HBB: c.92 + 6T > C) in a Chinese Family.
Chen B; Huang P; Yi S; Chen Q; Tang Y; Zhang Q; He S
Hemoglobin; 2015; 39(3):207-8. PubMed ID: 25856402
[TBL] [Abstract][Full Text] [Related]
38. [Improvement of detection of paternally inherited fetal mutant genes for β-globin in maternal plasma by PNA clamp].
Huang K; Pan HF
Zhonghua Xue Ye Xue Za Zhi; 2013 Mar; 34(3):233-6. PubMed ID: 23683423
[TBL] [Abstract][Full Text] [Related]
39. Prenatal screening for β-thalassemia major reveals new and rare mutations in the Pakistani population.
Moatter T; Kausar T; Aban M; Ghani S; Pal JA
Int J Hematol; 2012 Apr; 95(4):394-8. PubMed ID: 22392582
[TBL] [Abstract][Full Text] [Related]
40. Optimized Droplet Digital PCR Assay on Cell-Free DNA Samples for Non-Invasive Prenatal Diagnosis: Application to Beta-Thalassemia.
Constantinou CG; Karitzi E; Byrou S; Stephanou C; Michailidou K; Makariou C; Hadjilambi G; Christofides A; Kleanthous M; Papasavva T
Clin Chem; 2022 Jul; 68(8):1053-1063. PubMed ID: 35652459
[TBL] [Abstract][Full Text] [Related]
[Previous] [Next] [New Search]
