159 related articles for article (PubMed ID: 34794358)
1. Updated Molecular Spectrum of β-Thalassemia Mutations in Duhok Province, Northern Iraq: Ethnic Variation and the Impact of Immigration.
Atroshi SD; Al-Allawi NAS; Eissa AA
Hemoglobin; 2021 Jul; 45(4):239-244. PubMed ID: 34794358
[TBL] [Abstract][Full Text] [Related]
2. β-Globin Gene Mutations in Pediatric Patients with β-Thalassemia in the Region of Çukurova, Turkey.
Guzelgul F; Seydel GS; Aksoy K
Hemoglobin; 2020 Jul; 44(4):249-253. PubMed ID: 32664780
[TBL] [Abstract][Full Text] [Related]
3. The Frequency of HBB Mutations Among β-Thalassemia Patients in Hamadan Province, Iran.
Jalilian M; Azizi Jalilian F; Ahmadi L; Amini R; Esfehani H; Sosanian M; Rabbani B; Maleki M; Mahdieh N
Hemoglobin; 2017 Jan; 41(1):61-64. PubMed ID: 28391758
[TBL] [Abstract][Full Text] [Related]
4. The Spectrum of β-Thalassemia Mutations in Siirt Province, Southeastern Turkey.
Yılmaz S
Hemoglobin; 2019 May; 43(3):174-181. PubMed ID: 31411089
[TBL] [Abstract][Full Text] [Related]
5. The Spectrum of β-Thalassemia Mutations in the Population Migration in Lebanon: A 6-Year Retrospective Study.
Farra C; Abdouni L; Souaid M; Awwad J; Yazbeck N; Abboud M
Hemoglobin; 2021 Nov; 45(6):365-370. PubMed ID: 33947296
[TBL] [Abstract][Full Text] [Related]
6. The Spectrum of β-Thalassemia Mutations in Hamadan Province, West Iran.
Alibakhshi R; Moradi K; Aznab M; Azimi A; Shafieenia S; Biglari M
Hemoglobin; 2019 Jan; 43(1):18-22. PubMed ID: 31096791
[TBL] [Abstract][Full Text] [Related]
7. Molecular Scanning of β-Thalassemia in the Southern Region of Central Java, Indonesia; a Step Towards a Local Prevention Program.
Rujito L; Basalamah M; Mulatsih S; Sofro AS
Hemoglobin; 2015; 39(5):330-3. PubMed ID: 26291967
[TBL] [Abstract][Full Text] [Related]
8. The Spectrum of β-Thalassemia Mutations in a Population from the Brazilian Amazon.
Silva AN; Cardoso GL; Cunha DA; Diniz IG; Santos SE; Andrade GB; Trindade SM; Cardoso Mdo S; Francês LT; Guerreiro JF
Hemoglobin; 2016; 40(1):20-4. PubMed ID: 26372288
[TBL] [Abstract][Full Text] [Related]
9. Molecular basis of β-thalassemia in the western province of Saudi Arabia: identification of rare β-thalassemia mutations.
Abuzenadah AM; Hussein IM; Damanhouri GA; A-Sayes FM; Gari MA; Chaudhary AG; Zaher GF; Al-Attas A; Al-Qahtani MH
Hemoglobin; 2011; 35(4):346-57. PubMed ID: 21797702
[TBL] [Abstract][Full Text] [Related]
10. Distribution of
Moradi K; Aznab M; Tahmasebi S; Omidniakan L; Bijari N; Alibakhshi R
Hemoglobin; 2020 Jul; 44(4):244-248. PubMed ID: 32869674
[TBL] [Abstract][Full Text] [Related]
11. Molecular update of β-thalassemia mutations in the Syrian population: identification of rare β-thalassemia mutations.
Jarjour RA; Murad H; Moasses F; Al-Achkar W
Hemoglobin; 2014; 38(4):272-6. PubMed ID: 24828949
[TBL] [Abstract][Full Text] [Related]
12. β-Thalassemia mutations in the Kurdish population of northeastern Iraq.
Jalal SD; Al-Allawi NA; Bayat N; Imanian H; Najmabadi H; Faraj A
Hemoglobin; 2010; 34(5):469-76. PubMed ID: 20854121
[TBL] [Abstract][Full Text] [Related]
13. Molecular Characterization of β-Thalassemia Intermedia in Southeast Iran.
Miri-Moghaddam E; Bahrami S; Naderi M; Bazi A; Karimipoor M
Hemoglobin; 2016 Jun; 40(3):173-8. PubMed ID: 27117567
[TBL] [Abstract][Full Text] [Related]
14. Molecular Basis of β-Thalassemia in the Population of the Aegean Region of Turkey: Identification of A Novel Deletion Mutation.
Ozkinay F; Onay H; Karaca E; Arslan E; Erturk B; Ece Solmaz A; Tekin IM; Cogulu O; Aydinok Y; Vergin C
Hemoglobin; 2015; 39(4):230-4. PubMed ID: 26076395
[TBL] [Abstract][Full Text] [Related]
15. The spectrum of β-thalassemia mutations in Baghdad, Central Iraq.
Al-Allawi NA; Al-Mousawi BM; Badi AI; Jalal SD
Hemoglobin; 2013; 37(5):444-53. PubMed ID: 23826747
[TBL] [Abstract][Full Text] [Related]
16. Molecular Spectrum of β-Thalassemia Mutations in Central to Eastern Thailand.
Panichchob P; Iamdeelert P; Wongsariya P; Wongsariya P; Wongwattanasanti P; Tepakhan W; Jomoui W
Hemoglobin; 2021 Mar; 45(2):97-102. PubMed ID: 33966551
[TBL] [Abstract][Full Text] [Related]
17. Mutational Profile of Homozygous β-Thalassemia in Rio de Janeiro, Brazil.
Carrocini GCS; Venancio LPR; Pessoa VLR; Lobo CLC; Bonini-Domingos CR
Hemoglobin; 2017 Jan; 41(1):12-15. PubMed ID: 28366028
[TBL] [Abstract][Full Text] [Related]
18. β-Thalassemia Haplotypes in Romania in the Context of Genetic Mixing in the Mediterranean Area.
Cherry L; Calo C; Talmaci R; Perrin P; Gavrila L
Hemoglobin; 2016; 40(2):85-96. PubMed ID: 26711012
[TBL] [Abstract][Full Text] [Related]
19. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.
Rizo-de-la-Torre LC; Ibarra B; Sánchez-López JY; Magaña-Torres MT; Rentería-López VM; Perea-Díaz FJ
Int J Lab Hematol; 2017 Oct; 39(5):539-545. PubMed ID: 28603845
[TBL] [Abstract][Full Text] [Related]
20. Molecular Heterogeneity of β-Thalassemia in the Kohat Region, Khyber Pakhtunkhwa Province, Pakistan.
Naz S; Rehman SU; Shakeel M; Rehman H; Hussain M; Haider A
Hemoglobin; 2020 Jan; 44(1):37-41. PubMed ID: 32079421
[TBL] [Abstract][Full Text] [Related]
[Next] [New Search]
