These tools will no longer be maintained as of December 31, 2024. Archived website can be found here. PubMed4Hh GitHub repository can be found here. Contact NLM Customer Service if you have questions.


BIOMARKERS

Molecular Biopsy of Human Tumors

- a resource for Precision Medicine *

182 related articles for article (PubMed ID: 35031571)

  • 21. Prevalence and molecular characterization of β-thalassemia in the state of Bahia, Brazil: first identification of mutation HBB: c.135delC in Brazil.
    Fonseca SF; Moura Neto JP; Goncalves MS
    Hemoglobin; 2013; 37(3):285-90. PubMed ID: 23425035
    [TBL] [Abstract][Full Text] [Related]  

  • 22. A
    Gürlek-Gökçebay D; Akpinar-Tekgunduz S; Erdem HB; Yarali N
    Hemoglobin; 2019; 43(4-5):277-279. PubMed ID: 31530045
    [TBL] [Abstract][Full Text] [Related]  

  • 23. Presentation of two new mutations in the 3'untranslated region of the β-globin gene and evaluating the molecular spectrum of thalassemia mutations in the Mediterranean region of Turkey.
    Arpaci A; Gul BU; Ozcan O; Ilhan G; El C; Dirican E; Elmacioglu S; Kaya H
    Ann Hematol; 2021 Jun; 100(6):1429-1438. PubMed ID: 33851260
    [TBL] [Abstract][Full Text] [Related]  

  • 24. Molecular and phenotype characterization of an elongated β-globin variant produced by HBB:C.313delA.
    Lin W; Zhang Q; Shen Z; Qu X; Wang Q; Wei L; Qiu Y; Yang J; Xu X; Lao J
    Int J Lab Hematol; 2021 Dec; 43(6):1620-1627. PubMed ID: 34271589
    [TBL] [Abstract][Full Text] [Related]  

  • 25. The Spectrum of β-Thalassemia Mutations in Siirt Province, Southeastern Turkey.
    Yılmaz S
    Hemoglobin; 2019 May; 43(3):174-181. PubMed ID: 31411089
    [TBL] [Abstract][Full Text] [Related]  

  • 26. Mutational spectrum of delta-globin gene in the Portuguese population.
    Morgado A; Picanço I; Gomes S; Miranda A; Coucelo M; Seuanes F; Seixas MT; Romão L; Faustino P
    Eur J Haematol; 2007 Nov; 79(5):422-8. PubMed ID: 17916081
    [TBL] [Abstract][Full Text] [Related]  

  • 27. A Universal Approach to Correct Various HBB Gene Mutations in Human Stem Cells for Gene Therapy of Beta-Thalassemia and Sickle Cell Disease.
    Cai L; Bai H; Mahairaki V; Gao Y; He C; Wen Y; Jin YC; Wang Y; Pan RL; Qasba A; Ye Z; Cheng L
    Stem Cells Transl Med; 2018 Jan; 7(1):87-97. PubMed ID: 29164808
    [TBL] [Abstract][Full Text] [Related]  

  • 28. Compound Heterozygote of Hb S (HBB: c.20A>T)/Hb Westdale (HBB: c.380_396delTGCAGGCTGCCTATCAG): Report of Four Cases from Odisha State, India.
    Dehury S; Meher S; Patel S; Das K; Jana A; Bhattacharya S; Sahoo S; Sarkar B; Mohanty PK
    Hemoglobin; 2019 Mar; 43(2):132-136. PubMed ID: 31190580
    [TBL] [Abstract][Full Text] [Related]  

  • 29. A Novel Frameshift Mutation at Codon 2 (-T) (
    Bayramov B; Aliyeva G; Asadov C; Mammadova T; Karimova N; Eynullazadeh K; Gafarova S; Akbarov S; Farhadova S; Safarzadeh Z; Abbasov M
    Hemoglobin; 2019; 43(4-5):280-282. PubMed ID: 31476942
    [TBL] [Abstract][Full Text] [Related]  

  • 30. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.
    Rizo-de-la-Torre LC; Ibarra B; Sánchez-López JY; Magaña-Torres MT; Rentería-López VM; Perea-Díaz FJ
    Int J Lab Hematol; 2017 Oct; 39(5):539-545. PubMed ID: 28603845
    [TBL] [Abstract][Full Text] [Related]  

  • 31. A rare gene variation cap +1 (A>C) (HBB: c. -50A>C) associated with codon 5 (-CT) (HBB: c.17_18delCT) mutation in Syrian family.
    Murad H; Moassas F; Fakseh NAL
    Mol Genet Genomic Med; 2021 Mar; 9(3):e1602. PubMed ID: 33491330
    [TBL] [Abstract][Full Text] [Related]  

  • 32. The Frequency of HBB Mutations Among β-Thalassemia Patients in Hamadan Province, Iran.
    Jalilian M; Azizi Jalilian F; Ahmadi L; Amini R; Esfehani H; Sosanian M; Rabbani B; Maleki M; Mahdieh N
    Hemoglobin; 2017 Jan; 41(1):61-64. PubMed ID: 28391758
    [TBL] [Abstract][Full Text] [Related]  

  • 33. Correction of β-thalassemia mutant by base editor in human embryos.
    Liang P; Ding C; Sun H; Xie X; Xu Y; Zhang X; Sun Y; Xiong Y; Ma W; Liu Y; Wang Y; Fang J; Liu D; Songyang Z; Zhou C; Huang J
    Protein Cell; 2017 Nov; 8(11):811-822. PubMed ID: 28942539
    [TBL] [Abstract][Full Text] [Related]  

  • 34. Molecular Scanning of β-Thalassemia in the Southern Region of Central Java, Indonesia; a Step Towards a Local Prevention Program.
    Rujito L; Basalamah M; Mulatsih S; Sofro AS
    Hemoglobin; 2015; 39(5):330-3. PubMed ID: 26291967
    [TBL] [Abstract][Full Text] [Related]  

  • 35. A Novel Mutation in the Promoter Region of the β-Globin Gene: HBB: c.-127G > C.
    Bilgen T; Canatan D; Delibas S; Keser I
    Hemoglobin; 2016 Aug; 40(4):280-2. PubMed ID: 27349616
    [TBL] [Abstract][Full Text] [Related]  

  • 36. β+-Thalassemia trait due to a novel mutation in the β-globin gene promoter: -26 (A>C) [HBB c.-76A>C].
    Waye JS; Nakamura-Garrett LM; Eng B; Kanavakis E; Traeger-Synodinos J
    Hemoglobin; 2011; 35(1):84-6. PubMed ID: 21250885
    [TBL] [Abstract][Full Text] [Related]  

  • 37. Description of a rare β-globin gene mutation, IVS-II-848 (C>A) (
    Shoujaa A; Mukhalalaty Y; Murad H; Al-Quobaili F
    Hemoglobin; 2019; 43(4-5):283-285. PubMed ID: 31718331
    [TBL] [Abstract][Full Text] [Related]  

  • 38. IVS-II-16 (G>C) (
    Uçucu S; Karabıyık T; Azik FM
    Hemoglobin; 2021 Jul; 45(4):225-227. PubMed ID: 34396882
    [TBL] [Abstract][Full Text] [Related]  

  • 39. A new δ chain variant, Hb A2-Tunis [δ46(CD5)Gly → Glu; HBD: c.140G>A], observed in a Tunisian family in association with a compound heterozygosity for Hb C [β6(A3)Glu → Lys; HBB: c.19G>A] β(0)-thalassemia [IVS-I-1 (β143, G>A); HBB: c.92+1G>A].
    Moumni I; Zorai A; Mahjoub S; Mosbahi I; Chaouechi D; Benromdhane N; Abbes S
    Hemoglobin; 2014; 38(2):88-90. PubMed ID: 24471655
    [TBL] [Abstract][Full Text] [Related]  

  • 40. Compound heterozygosity of a silent beta-thalassemia mutation at the 3'-untranslated region (HBB: c.*132 C>T) and beta-zero thalassemia results in thalassemia intermedia.
    Sripusanapan A; Phusua A; Fanhchaksai K; Charoenkwan P
    Pediatr Blood Cancer; 2020 Apr; 67(4):e28157. PubMed ID: 31930713
    [No Abstract]   [Full Text] [Related]  

    [Previous]   [Next]    [New Search]
    of 10.