These tools will no longer be maintained as of December 31, 2024. Archived website can be found here. PubMed4Hh GitHub repository can be found here. Contact NLM Customer Service if you have questions.


BIOMARKERS

Molecular Biopsy of Human Tumors

- a resource for Precision Medicine *

124 related articles for article (PubMed ID: 35851204)

  • 1. Genetic heterogeneity of beta thalassemia mutations in Kahramanmaraş province in Southern Turkey: preliminary report.
    Kurutaş EB; Aksan ME; Curuk P; Curuk MA
    Folia Med (Plovdiv); 2021 Oct; 63(5):697-703. PubMed ID: 35851204
    [TBL] [Abstract][Full Text] [Related]  

  • 2. Genetic heterogeneity of beta-thalassemia at Cukurova in southern Turkey.
    Cürük MA; Arpaci A; Attila G; Tuli A; Kilinç Y; Aksoy K; Yüreğir GT
    Hemoglobin; 2001 May; 25(2):241-5. PubMed ID: 11480785
    [TBL] [Abstract][Full Text] [Related]  

  • 3. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.
    Rizo-de-la-Torre LC; Ibarra B; Sánchez-López JY; Magaña-Torres MT; Rentería-López VM; Perea-Díaz FJ
    Int J Lab Hematol; 2017 Oct; 39(5):539-545. PubMed ID: 28603845
    [TBL] [Abstract][Full Text] [Related]  

  • 4. The molecular pathology of beta-thalassemia in Turkey: the Boğaziçi university experience.
    Basak AN
    Hemoglobin; 2007; 31(2):233-41. PubMed ID: 17486506
    [TBL] [Abstract][Full Text] [Related]  

  • 5. Molecular basis of β-thalassemia in the western province of Saudi Arabia: identification of rare β-thalassemia mutations.
    Abuzenadah AM; Hussein IM; Damanhouri GA; A-Sayes FM; Gari MA; Chaudhary AG; Zaher GF; Al-Attas A; Al-Qahtani MH
    Hemoglobin; 2011; 35(4):346-57. PubMed ID: 21797702
    [TBL] [Abstract][Full Text] [Related]  

  • 6. Molecular spectrum of beta-thalassemia in the Mexican population.
    Perea FJ; Magaña MT; Cobián JG; Sánchez-López JY; Chávez ML; Zamudio G; Esparza MA; López-Guido B; Ibarra B
    Blood Cells Mol Dis; 2004; 33(2):150-2. PubMed ID: 15315794
    [TBL] [Abstract][Full Text] [Related]  

  • 7. β-Globin Gene Mutations in Pediatric Patients with β-Thalassemia in the Region of Çukurova, Turkey.
    Guzelgul F; Seydel GS; Aksoy K
    Hemoglobin; 2020 Jul; 44(4):249-253. PubMed ID: 32664780
    [TBL] [Abstract][Full Text] [Related]  

  • 8. Molecular genetic analyses of beta-thalassemia in South India reveals rare mutations in the beta-globin gene.
    Bashyam MD; Bashyam L; Savithri GR; Gopikrishna M; Sangal V; Devi ARR
    J Hum Genet; 2004; 49(8):408-413. PubMed ID: 15278762
    [TBL] [Abstract][Full Text] [Related]  

  • 9. Analysis of beta-thalassemia mutations and beta-locus control region hypersensitive sites 2, 3 and 4 in southern Thailand.
    Sriroongrueng W; Schleiemacher E; Panich V; Nopparatana C; Saechan V; Laosombat V; Pornpatkul M; Fukumaki Y
    Southeast Asian J Trop Med Public Health; 1997; 28 Suppl 3():120-7. PubMed ID: 9640613
    [TBL] [Abstract][Full Text] [Related]  

  • 10. Beta-thalassemia intermedia from southern Iran: IVS-II-1 (G-->A) is the prevalent thalassemia intermedia allele.
    Karimi M; Yarmohammadi H; Farjadian S; Zeinali S; Moghaddam Z; Cappellini MD; Giordano PC
    Hemoglobin; 2002 May; 26(2):147-54. PubMed ID: 12144057
    [TBL] [Abstract][Full Text] [Related]  

  • 11. The great heterogeneity of thalassemia molecular defects in Sicily.
    Giambona A; Lo Gioco P; Marino M; Abate I; Di Marzo R; Renda M; Di Trapani F; Messana F; Siciliano S; Rigano P
    Hum Genet; 1995 May; 95(5):526-30. PubMed ID: 7759073
    [TBL] [Abstract][Full Text] [Related]  

  • 12. combination of IVS2.849 A-G witH IVS1.1 G-A: a mutation of beta-globin gene in a Turkish beta-thalessemia major patient.
    Manguoğlu E; Sargin CF; Nal N; Keser I; Küpesiz A; Yeşilipek A; Lüleci G
    Pediatr Hematol Oncol; 2005 Jun; 22(4):291-5. PubMed ID: 16020116
    [TBL] [Abstract][Full Text] [Related]  

  • 13. Molecular defects in the beta-globin gene identified in different ethnic groups/populations during prenatal diagnosis for beta-thalassemia: a Malaysian experience.
    Tan JA; George E; Tan KL; Chow T; Tan PC; Hassan J; Chia P; Subramanium R; Chandran R; Yap SF
    Clin Exp Med; 2004 Dec; 4(3):142-7. PubMed ID: 15599663
    [TBL] [Abstract][Full Text] [Related]  

  • 14. Genetic diversity of beta-thalassemia mutations in Pakistani population.
    Khateeb B; Moatter T; Shaghil AM; Haroon S; Kakepoto GN
    J Pak Med Assoc; 2000 Sep; 50(9):293-6. PubMed ID: 11043018
    [TBL] [Abstract][Full Text] [Related]  

  • 15. Molecular analysis of beta-thalassaemia patients in a high incidence area of southern Italy.
    Rigoli L; Meo A; Miceli MR; Alessio K; Caruso RA; La Rosa MA; Salpietro DC; Ricca M; Barberi I
    Clin Lab Haematol; 2001 Dec; 23(6):373-8. PubMed ID: 11843884
    [TBL] [Abstract][Full Text] [Related]  

  • 16. The spectrum of β-thalassemia mutations in Hatay, Turkey: reporting three new mutations.
    Aldemir O; Izmirli M; Kaya H
    Hemoglobin; 2014; 38(5):325-8. PubMed ID: 25155404
    [TBL] [Abstract][Full Text] [Related]  

  • 17. Jamaican Sbeta+-thalassaemia: mutations and haematology.
    Donaldson A; Old J; Fisher C; Serjeant BE; Serjeant GR
    Br J Haematol; 2000 Feb; 108(2):290-4. PubMed ID: 10691857
    [TBL] [Abstract][Full Text] [Related]  

  • 18. The molecular analysis of beta-thalassemia mutations in Lorestan Province, Iran.
    Kiani AA; Mortazavi Y; Zeinali S; Shirkhani Y
    Hemoglobin; 2007; 31(3):343-9. PubMed ID: 17654071
    [TBL] [Abstract][Full Text] [Related]  

  • 19. Spectrum of beta-globin gene mutations among thalassemia patients in the West Bank region of Palestine.
    Darwish HM; El-Khatib FF; Ayesh S
    Hemoglobin; 2005; 29(2):119-32. PubMed ID: 15921164
    [TBL] [Abstract][Full Text] [Related]  

  • 20. A Particular Focus on the Prevalence of
    Daidone R; Carollo A; Perricone MP; Messina R; Balistreri CR
    Int J Mol Sci; 2023 Mar; 24(5):. PubMed ID: 36902239
    [TBL] [Abstract][Full Text] [Related]  

    [Next]    [New Search]
    of 7.