These tools will no longer be maintained as of December 31, 2024. Archived website can be found here. PubMed4Hh GitHub repository can be found here. Contact NLM Customer Service if you have questions.
113 related articles for article (PubMed ID: 9021814)
1. Beta-thalassemia alleles in Aegean region of Turkey: effect on clinical severity of disease. Nişli G; Kavakli K; Aydinok Y; Oztop S; Cetingül N Pediatr Hematol Oncol; 1997; 14(1):59-65. PubMed ID: 9021814 [TBL] [Abstract][Full Text] [Related]
2. Rapid screening of multiple beta-globin gene mutations by real-time PCR on the LightCycler: application to carrier screening and prenatal diagnosis of thalassemia syndromes. Vrettou C; Traeger-Synodinos J; Tzetis M; Malamis G; Kanavakis E Clin Chem; 2003 May; 49(5):769-76. PubMed ID: 12709368 [TBL] [Abstract][Full Text] [Related]
3. Spectrum of beta-thalassemia mutations and their association with allelic sequence polymorphisms at the beta-globin gene cluster in an Eastern Indian population. Kukreti R; Dash D; E VK; Chakravarty S; Das SK; De M; Talukder G Am J Hematol; 2002 Aug; 70(4):269-77. PubMed ID: 12210807 [TBL] [Abstract][Full Text] [Related]
4. Comparative in vivo expression of beta(+)-thalassemia alleles. Marwan MM; Scerri CA; Zarroag SO; Cao A; Kyrri A; Kalogirou E; Kleanthous M; Ioannou P; Angastiniotis M; Felice AE Hemoglobin; 1999 Aug; 23(3):221-9. PubMed ID: 10490134 [TBL] [Abstract][Full Text] [Related]
5. Spectrum of beta-globin gene mutations among thalassemia patients in the West Bank region of Palestine. Darwish HM; El-Khatib FF; Ayesh S Hemoglobin; 2005; 29(2):119-32. PubMed ID: 15921164 [TBL] [Abstract][Full Text] [Related]
6. History and origin of beta-thalassemia in Turkey: sequence haplotype diversity of beta-globin genes. Tadmouri GO; Garguier N; Demont J; Perrin P; Başak AN Hum Biol; 2001 Oct; 73(5):661-74. PubMed ID: 11758688 [TBL] [Abstract][Full Text] [Related]
7. The clinical significance of the spectrum of interactions of CAP+1 (A-->C), a silent beta-globin gene mutation, with other beta-thalassemia mutations and globin gene modifiers in north Indians. Garewal G; Das R; Awasthi A; Ahluwalia J; Marwaha RK Eur J Haematol; 2007 Nov; 79(5):417-21. PubMed ID: 17900295 [TBL] [Abstract][Full Text] [Related]
8. A comprehensive molecular characterization of beta thalassemia in a highly heterogeneous population. Akhavan-Niaki H; Derakhshandeh-Peykar P; Banihashemi A; Mostafazadeh A; Asghari B; Ahmadifard MR; Azizi M; Youssefi A; Elmi MM Blood Cells Mol Dis; 2011 Jun; 47(1):29-32. PubMed ID: 21493114 [TBL] [Abstract][Full Text] [Related]
10. Molecular Basis of β-Thalassemia in the Population of the Aegean Region of Turkey: Identification of A Novel Deletion Mutation. Ozkinay F; Onay H; Karaca E; Arslan E; Erturk B; Ece Solmaz A; Tekin IM; Cogulu O; Aydinok Y; Vergin C Hemoglobin; 2015; 39(4):230-4. PubMed ID: 26076395 [TBL] [Abstract][Full Text] [Related]
11. Development of a new real-time PCR screening kit for HbS and common beta-thalassemia mutations observed in Turkey. Kan Karaer D; Ergün MA; Ruhi HI; Öztürk J; Kara H; Reisoğlu Çakmak D; Aydoğmuş T; Perçin EF Turk J Med Sci; 2017 Jun; 47(3):973-978. PubMed ID: 28618753 [TBL] [Abstract][Full Text] [Related]
12. Spectrum of beta thalassemia mutations and their linkage to beta-globin gene haplotypes in the Indo-Mauritians. Kotea N; Ramasawmy R; Lu CY; Fa NS; Gerard N; Beesoon S; Ducrocq R; Surrun SK; Nagel RL; Krishnamoorthy R Am J Hematol; 2000 Jan; 63(1):11-5. PubMed ID: 10602161 [TBL] [Abstract][Full Text] [Related]
13. The molecular pathology of beta-thalassemia in Turkey: the Boğaziçi university experience. Basak AN Hemoglobin; 2007; 31(2):233-41. PubMed ID: 17486506 [TBL] [Abstract][Full Text] [Related]
15. The molecular basis of beta-thalassemia in Turkey. Başak AN; Ozçelik H; Ozer A; Tolun A; Aksoy M; Ağaoğlu L; Ridolfi F; Ulukutlu L; Akar N; Gürgey A Hum Genet; 1992 May; 89(3):315-8. PubMed ID: 1351036 [TBL] [Abstract][Full Text] [Related]
16. Accurate and rapid prenatal diagnosis of the most frequent East Mediterranean beta-thalassemia mutations. Naja RP; Kaspar H; Shbaklo H; Chakar N; Makhoul NJ; Zalloua PA Am J Hematol; 2004 Apr; 75(4):220-4. PubMed ID: 15054814 [TBL] [Abstract][Full Text] [Related]
17. Genetic heterogeneity of beta thalassemia mutations in Kahramanmaraş province in Southern Turkey: preliminary report. Kurutaş EB; Aksan ME; Curuk P; Curuk MA Folia Med (Plovdiv); 2021 Oct; 63(5):697-703. PubMed ID: 35851204 [TBL] [Abstract][Full Text] [Related]
18. Molecular pathogenesis and clinical variability of homozygous beta0-thalassemia in populations of Jammu region of J&K state (India). Singh SP; Gupta S Hematology; 2006 Aug; 11(4):271-5. PubMed ID: 17178667 [TBL] [Abstract][Full Text] [Related]
19. Molecular basis of beta thalassemia in the south of Thailand. Laosombat V; Fucharoen SP; Panich V; Fucharoen G; Wongchanchailert M; Sriroongrueng W; Nopparatana C; Kenpitak K; Maipang M; Fukumaki Y Am J Hematol; 1992 Nov; 41(3):194-8. PubMed ID: 1415194 [TBL] [Abstract][Full Text] [Related]
20. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients. Rizo-de-la-Torre LC; Ibarra B; Sánchez-López JY; Magaña-Torres MT; Rentería-López VM; Perea-Díaz FJ Int J Lab Hematol; 2017 Oct; 39(5):539-545. PubMed ID: 28603845 [TBL] [Abstract][Full Text] [Related] [Next] [New Search]