136 related articles for article (PubMed ID: 9099840)
1. Beta-thalassemia and beta[A] globin gene haplotypes in Mexican mestizos.
Villalobos-Arámbula AR; Bustos R; Casas-Castañeda M; Gutiérrez E; Perea FJ; Thein SL; Ibarra B
Hum Genet; 1997 Apr; 99(4):498-500. PubMed ID: 9099840
[TBL] [Abstract][Full Text] [Related]
2. Haplotype analysis of the Mexican frameshift Cd 11 (-T) and -28 A->C beta-thalassemia alleles.
Perea FJ; Esparza MA; Villalobos-Arambula AR; Ibarra B; Old JM
Am J Hematol; 1996 Mar; 51(3):240-2. PubMed ID: 8619407
[TBL] [Abstract][Full Text] [Related]
3. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.
Rizo-de-la-Torre LC; Ibarra B; Sánchez-López JY; Magaña-Torres MT; Rentería-López VM; Perea-Díaz FJ
Int J Lab Hematol; 2017 Oct; 39(5):539-545. PubMed ID: 28603845
[TBL] [Abstract][Full Text] [Related]
4. beta haplotypes of three Mexican Mestizo families with Spanish (delta beta)o-thalassemia.
Villalobos-Arámbula AR; Bustos R; Perea FJ; Ibarra B; Vázquez V; Romero F; Craig JE; Thein SL
Hemoglobin; 1996 Nov; 20(4):439-42. PubMed ID: 8936470
[No Abstract] [Full Text] [Related]
5. Diversity of the 5' beta-globin haplotype of four beta-thalassemia mutations in the Mexican population.
Morales KR; Magaña MT; Ibarra B; Perea FJ
Hemoglobin; 2009; 33(1):66-71. PubMed ID: 19205976
[TBL] [Abstract][Full Text] [Related]
6. Molecular spectrum of beta-thalassemia in the Mexican population.
Perea FJ; Magaña MT; Cobián JG; Sánchez-López JY; Chávez ML; Zamudio G; Esparza MA; López-Guido B; Ibarra B
Blood Cells Mol Dis; 2004; 33(2):150-2. PubMed ID: 15315794
[TBL] [Abstract][Full Text] [Related]
7. Spectrum of beta thalassemia mutations and their linkage to beta-globin gene haplotypes in the Indo-Mauritians.
Kotea N; Ramasawmy R; Lu CY; Fa NS; Gerard N; Beesoon S; Ducrocq R; Surrun SK; Nagel RL; Krishnamoorthy R
Am J Hematol; 2000 Jan; 63(1):11-5. PubMed ID: 10602161
[TBL] [Abstract][Full Text] [Related]
8. [Thalassemic alleles in Mexican mestizos].
Ibarra B; Perea FJ; Villalobos-Arámbula AR
Rev Invest Clin; 1995; 47(2):127-31. PubMed ID: 7610281
[TBL] [Abstract][Full Text] [Related]
9. β-Thalassemia Haplotypes in Romania in the Context of Genetic Mixing in the Mediterranean Area.
Cherry L; Calo C; Talmaci R; Perrin P; Gavrila L
Hemoglobin; 2016; 40(2):85-96. PubMed ID: 26711012
[TBL] [Abstract][Full Text] [Related]
10. Molecular analysis of complex cases of alpha- and beta-thalassemia in Mexican mestizo patients with microcytosis and hypochromia reveals two novel alpha(0) -thalassemia deletions - -(Mex1) and - -(Mex2).
de-la-Cruz-Salcedo EI; Ibarra B; Rizo-de-la-Torre LC; Sánchez-López JY; González-Mercado A; Harteveld CL; Perea-Díaz FJ
Int J Lab Hematol; 2016 Oct; 38(5):535-42. PubMed ID: 27339814
[TBL] [Abstract][Full Text] [Related]
11. Molecular characterization of alpha-thalassemia determinants, beta-thalassemia alleles, and beta S haplotypes among Kuwaiti Arabs.
Adekile AD; Gu LH; Baysal E; Haider MZ; al-Fuzae L; Aboobacker KC; al-Rashied A; Huisman TH
Acta Haematol; 1994; 92(4):176-81. PubMed ID: 7701914
[TBL] [Abstract][Full Text] [Related]
12. Beta Globin Gene Cluster Haplotypes in Beta Thalassemia in the Kurdistan Region of Iraq.
Al-Zebari S; Al-Allawi NA; Nerweyi F
Hemoglobin; 2023 May; 47(3):111-117. PubMed ID: 37529858
[TBL] [Abstract][Full Text] [Related]
13. A frameshift at codons 77/78 (-C): a novel beta-thalassemia mutation.
Perea FJ; Magaña MT; Esparza MA; Ibarra B
Hemoglobin; 2004 Aug; 28(3):261-5. PubMed ID: 15481896
[TBL] [Abstract][Full Text] [Related]
14. beta-globin gene cluster haplotypes associated with beta-thalassemia on Corsica island.
Falchi A; Giovannoni L; Vacca L; Latini V; Vona G; Varesi L
Am J Hematol; 2005 Jan; 78(1):27-32. PubMed ID: 15609277
[TBL] [Abstract][Full Text] [Related]
15. Haplotypes linked to three rare beta-thalassemia mutations, originally reported in Tunisia.
Bibi A; Messaoud T; Fattoum S
Hemoglobin; 2006; 30(2):175-81. PubMed ID: 16798642
[TBL] [Abstract][Full Text] [Related]
16. The peculiar spectrum of beta-thalassemia genes in Tunisia.
Chibani J; Vidaud M; Duquesnoy P; Bergé-Lefranc JL; Pirastu M; Ellouze F; Rosa J; Goossens M
Hum Genet; 1988 Feb; 78(2):190-2. PubMed ID: 3422218
[TBL] [Abstract][Full Text] [Related]
17. Molecular spectrum of β-thalassemia mutations in the admixed Venezuelan population, and their linkage to β-globin gene haplotypes.
Bravo-Urquiola M; Arends A; Gómez G; Montilla S; Gerard N; Chacin M; Berbar T; García O; García G; Velasquez D; Castillo O; Krishnamoorthy R
Hemoglobin; 2012; 36(3):209-18. PubMed ID: 22563936
[TBL] [Abstract][Full Text] [Related]
18. Hb Lepore Washington-Boston in two Mexican mestizo families.
Ibarra B; Casas-Castañeda M; Villalobos-Arámbula AR; Zamudio G; Perea FJ; Rodríguez J; Pérez-Romano B; Ruiz-Argüelles G; Abarca-Salvatori A; Huisman TH; Gu LG; Ruiz-Reyes G
Rev Invest Clin; 1997; 49(3):221-3. PubMed ID: 9294962
[TBL] [Abstract][Full Text] [Related]
19. History and origin of beta-thalassemia in Turkey: sequence haplotype diversity of beta-globin genes.
Tadmouri GO; Garguier N; Demont J; Perrin P; Başak AN
Hum Biol; 2001 Oct; 73(5):661-74. PubMed ID: 11758688
[TBL] [Abstract][Full Text] [Related]
20. Hb D-Los Angeles associated with Hb S or beta-thalassemia in four Mexican Mestizo families.
Perea FJ; Casas-Castañeda M; Villalobos-Arámbula AR; Barajas H; Alvarez F; Camacho A; Hermosillo RM; Ibarra B
Hemoglobin; 1999 Aug; 23(3):231-7. PubMed ID: 10490135
[TBL] [Abstract][Full Text] [Related]
[Next] [New Search]
