These tools will no longer be maintained as of December 31, 2024. Archived website can be found here. PubMed4Hh GitHub repository can be found here. Contact NLM Customer Service if you have questions.


Pubmed for Handhelds

PUBMED FOR HANDHELDS

Search MEDLINE/PubMed

  • Title: CpG ODN 2006 and IL-12 are comparable for priming Th1 lymphocyte and IgG responses in cattle immunized with a rickettsial outer membrane protein in alum.
    Author: Zhang Y, Palmer GH, Abbott JR, Howard CJ, Hope JC, Brown WC.
    Journal: Vaccine; 2003 Jul 04; 21(23):3307-18. PubMed ID: 12804862.
    Abstract:
    Immunostimulatory oligodeoxynucleotides containing unmethylated CpG dinucleotides (CpG ODN) stimulate IL-12-dependent Th1 dominated cytokine and enhanced IgG responses when co-delivered with antigen to mice. However, the CpG ODN sequences that are optimal for each mammalian species may differ. Previously, we demonstrated that a CpG ODN containing the GTCGTT motif was optimal for stimulating bovine B cell proliferation, and induced IL-6, IL-12 and IFN-gamma production by peripheral blood mononuclear cells (PBMC). The current study was designed to test the hypothesis that the nuclease resistant phosphorothioate modified ODN 2006 (TCGTCGTTTTGTCGTTTTGTCGTT) would induce antigen-specific type 1 cytokine and enhanced IgG responses similar to those induced by IL-12. To test this adjuvant effect, calves were immunized with Anaplasma marginale major surface protein 2 (MSP2) with alum alone or combined with CpG ODN 2006, non-CpG ODN R2006 or IL-12. MSP2-specific IgG1 and IgG2 responses developed more rapidly in calves given IL-12, ODN 2006 or ODN R2006, but the highest IgG1 titers were obtained in CpG ODN-immunized calves. Antigen-specific lymphocyte proliferation and frequency of IFN-gamma-secreting cells were significantly increased in CpG ODN 2006- or IL-12-treated calves, and antigen-stimulated PBMC from these calves also expressed higher levels of IFN-gamma transcripts and lower levels of IL-4 transcripts. No differences in IL-10 mRNA expression were detected among the groups. These results indicate that CpG ODN 2006 is an effective vaccine adjuvant for stimulating both antibody and IFN-gamma mediated cellular immune responses in cattle.
    [Abstract] [Full Text] [Related] [New Search]