These tools will no longer be maintained as of December 31, 2024. Archived website can be found here. PubMed4Hh GitHub repository can be found here. Contact NLM Customer Service if you have questions.


Pubmed for Handhelds

PUBMED FOR HANDHELDS

Search MEDLINE/PubMed

  • Title: Mouse sterol response element binding protein-1c gene expression is negatively regulated by thyroid hormone.
    Author: Hashimoto K, Yamada M, Matsumoto S, Monden T, Satoh T, Mori M.
    Journal: Endocrinology; 2006 Sep; 147(9):4292-302. PubMed ID: 16794015.
    Abstract:
    Sterol regulatory element-binding protein (SREBP)-1c is a key regulator of fatty acid metabolism and plays a pivotal role in the transcriptional regulation of different lipogenic genes mediating lipid synthesis. In previous studies, the regulation of SREBP-1c mRNA levels by thyroid hormone has remained controversial. In this study, we examined whether T3 regulates the mouse SREBP-1c mRNA expression. We found that T3 negatively regulates the mouse SREBP-1c gene expression in the liver, as shown by ribonuclease protection assays and real-time quantitative RT-PCR. Promoter analysis with luciferase assays using HepG2 and Hepa1-6 cells revealed that T3 negatively regulates the mouse SREBP-1c gene promoter (-574 to +42) and that Site2 (GCCTGACAGGTGAAATCGGC) located around the transcriptional start site is responsible for the negative regulation by T3. Gel shift assays showed that retinoid X receptor-alpha/thyroid hormone receptor-beta heterodimer bound to Site2, but retinoid X receptor-alpha/liver X receptor- heterodimer could not bind to the site. In vivo chromatin immunoprecipitation assays demonstrated that T3 induced thyroid hormone receptor-beta recruitment to Site2. Thus, we demonstrated that mouse SREBP-1c mRNA is down-regulated by T3 in vivo and that T3 negatively regulates mouse SREBP-1c gene transcription via a novel negative thyroid hormone response element: Site2.
    [Abstract] [Full Text] [Related] [New Search]