These tools will no longer be maintained as of December 31, 2024. Archived website can be found here. PubMed4Hh GitHub repository can be found here. Contact NLM Customer Service if you have questions.


PUBMED FOR HANDHELDS

Search MEDLINE/PubMed


  • Title: Investigation of non-covalent interaction of natural flexible cyclic molecules with telomeric RNA G-quadruplexes by electrospray ionization mass spectrometry.
    Author: Cui X, Lin S, Zhou J, Yuan G.
    Journal: Rapid Commun Mass Spectrom; 2012 Aug 30; 26(16):1803-9. PubMed ID: 22777782.
    Abstract:
    RATIONALE: Recently, human telomeric DNA was found to be transcribed into RNA transcripts composing of tandem repeats of r(UUAGGG) which can form G-quadruplex structures. Studies have shown that human telomeric RNA is associated with the telomerase activity in vitro. Finding high affinity small molecule ligands binding to the telomeric RNA G-quadruplex may facilitate the regulation of the telomerase activity. METHODS: The 12-mer and 24-mer telomeric RNA sequences, r(UAGGGUUAGGGU) and r(UAGGGUUAGGGUUAGGGUUAGGGU), were synthesized by TaKaRa Biotechnology (Dalian) Co., Ltd. (TaKaRa, Dalian) with high-performance liquid chromatography (HPLC) purification. Electrospray ionization ion-trap mass spectrometry was used to evaluate the binding affinities of three natural flexible cyclic molecules, tetrandrine, fangchinoline and cepharanthine, with the telomeric RNA G-quadruplexes. The fragmentation pathways of the G-quadruplexes and G-quadruplex-ligand complexes were investigated by tandem mass spectrometry. RESULTS: the natural flexible cyclic molecules were found to have high binding affinities to the 12-mer and 24-mer RNA G-quadruplexes with stoichiometry of 1:1 to 3:1. Collision-induced dissociation tandem mass spectrometry shows that the G-quadruplex-ligand complexes lose neutral ammoniums first and the small molecule ligand subsequently. Besides, among the three flexible cyclic molecules, cepharanthine binds most tightly to the RNA G-quadruplexes than tetandrine and fangchinoline. CONCLUSIONS: Three flexible cyclic small molecules were found to be potential telomeric RNA G-quadruplex ligands, especially cepharanthine, which has high affinity and binds most tightly to the RNA G-quadruplexes. These findings may provide further implications in the regulation of telomeric RNA and telomerase activity.
    [Abstract] [Full Text] [Related] [New Search]