These tools will no longer be maintained as of December 31, 2024. Archived website can be found here. PubMed4Hh GitHub repository can be found here. Contact NLM Customer Service if you have questions.


Pubmed for Handhelds

PUBMED FOR HANDHELDS

Search MEDLINE/PubMed

  • Title: Molecular analysis of the dystrophin gene in 407 Chinese patients with Duchenne/Becker muscular dystrophy by the combination of multiplex ligation-dependent probe amplification and Sanger sequencing.
    Author: Chen WJ, Lin QF, Zhang QJ, He J, Liu XY, Lin MT, Murong SX, Liou CW, Wang N.
    Journal: Clin Chim Acta; 2013 Aug 23; 423():35-8. PubMed ID: 23588064.
    Abstract:
    BACKGROUND: Progressive muscular dystrophy is a leading neuromuscular disorder without any effective treatments and a common genetic cause of mortality among teenagers. A challenge exists in the screening of subtle mutations in 79 exons and little is known about the genotype-phenotype correlation. METHODS: Here we adopted multiplex ligation-dependent probe amplification and Sanger sequencing to detect the dystrophin gene in 407 patients and 76 mothers. RESULTS: Sixty-three percent (257/407) of the patients harbored a deletion or duplication mutation, with a de novo mutation frequency of 39.5% in 76 affected patients, and approximately 43.7% of the deletions occurred from exon 45 to 52. To those patients suspected with single exon deletion, combined with Sanger sequencing, five subtle mutations were identified: c.8608C>T, c.2302C>T, c.7148dupT, c.10855C>T and c.2071-2093del AGGGAACAGATCCTGGTAAAGCA; the last three mutations were novel. Furthermore, after genotype-phenotype analysis, the severity of DMD/BMD was associated with the frame shift mutation but not with the deletion, the duplication or the number of deleted exons. CONCLUSION: The majority of patients have a deletion/duplication mutation in the dystrophin gene, with a hot deletion mutation region from exon 45 to 52. Combined with Sanger sequencing, multiplex ligation-dependent probe amplification is capable of detecting part of subtle mutations.
    [Abstract] [Full Text] [Related] [New Search]