These tools will no longer be maintained as of December 31, 2024. Archived website can be found here. PubMed4Hh GitHub repository can be found here. Contact NLM Customer Service if you have questions.


PUBMED FOR HANDHELDS

Search MEDLINE/PubMed


  • Title: Transcriptional and posttranscriptional regulation of the tomato leaf mould disease resistance gene Cf-9.
    Author: Li W, Xu YP, Cai XZ.
    Journal: Biochem Biophys Res Commun; 2016 Jan 29; 470(1):163-167. PubMed ID: 26768363.
    Abstract:
    Plant disease resistance (R) genes confer effector-triggered immunity (ETI) to pathogens carrying complementary effector/avirulence (Avr) genes. They are traditionally recognized to function at translational and/or posttranslational levels. In this study, however, transcriptional and posttranscriptional regulation of Cf-9, a tomato R gene conferring resistance to leaf mould fungal pathogen carrying Avr9, was demonstrated. Expression of the Cf-9 gene was 10.8-54.7 folds higher in the Cf-9/Avr9 tomato lines than in the Cf-9 lines depending on the seedling age, indicating that the Cf-9 gene expression was strongly induced by Avr9. Moreover, expression of the Cf-9 gene in the 5-day-old Cf-9/Avr9 seedlings at 33 °C was approximately 80 folds lower than that at 25 °C, and was enhanced by 23.4 folds at only 4 h post temperature shift from 33 °C to 25 °C, demonstrating that the Avr9-mediated induction of the Cf-9 gene expression is reversibly repressed by high temperature. Expression of the Cf-9 gene in the Cf-9 seedlings was similarly affected by temperature as in the Cf-9/Avr9 seedlings, implying that the genetic control of temperature sensitivity of the Cf-9 gene expression is epistasis to its Avr9-mediated induction. Additionally, a miRNA sly-miR6022, TGGAAGGGAGAATATCCAGGA, targeting the leucine-rich repeat (LRR) domain spanning LRR13-LRR14 of the Cf-9 gene transcript was predicted. Over-expression of this miRNA resulted in over 88% reduction of the Cf-9 gene transcripts in both Nicotiana benthamiana and tomato, and thus verifying the function of sly-miR6022 in degrading the Cf-9 gene transcripts. Collectively, our results reveal that the tomato R gene Cf-9 is strongly regulated at transcriptional level by pathogen Avr9 in a temperature-sensitive manner and is also regulated at posttranscriptional level by a miRNA sly-miR6022.
    [Abstract] [Full Text] [Related] [New Search]