These tools will no longer be maintained as of December 31, 2024. Archived website can be found here. PubMed4Hh GitHub repository can be found here. Contact NLM Customer Service if you have questions.


Pubmed for Handhelds

PUBMED FOR HANDHELDS

Search MEDLINE/PubMed

  • Title: The nucleotide sequence of glycine tRNA from Mycoplasma mycoides sp. capri.
    Author: Kilpatrick MW, Walker RT.
    Journal: Nucleic Acids Res; 1980 Jun 25; 8(12):2783-6. PubMed ID: 7001357.
    Abstract:
    Using in vitro labelling techniques, a tRNAGly from M. mycoides sp. capri PG3 has been shown to have the sequence : pGCAGGUGs4UAGUUUAAUGGCAGAACUUC AGCCUUCCm6AAGCUGAUUGUGAGGGU psi CGAUUCCCUUCACCUGCUCCAOH. The anticodon is UCC and no other tRNAGly has been detected in the crude tRNA isolated from this organism. As is the case with some mitochondrial tRNAs, where the genome size of the organelle is small, it is possible that this tRNA is used to read all four glycine codons GGN.
    [Abstract] [Full Text] [Related] [New Search]