These tools will no longer be maintained as of December 31, 2024. Archived website can be found here. PubMed4Hh GitHub repository can be found here. Contact NLM Customer Service if you have questions.


PUBMED FOR HANDHELDS

Journal Abstract Search


89 related items for PubMed ID: 21250884

  • 1.
    ; . PubMed ID:
    [No Abstract] [Full Text] [Related]

  • 2. Sudanese (δβ)0-Thalassemia: Identification and Characterization of a Novel 9.6 kb Deletion.
    Waye JS, Eng B, Got T, Hanna M, Hohenadel BA, Nakamura LM, Walker L.
    Hemoglobin; 2015; 39(5):368-70. PubMed ID: 26154945
    [Abstract] [Full Text] [Related]

  • 3.
    ; . PubMed ID:
    [No Abstract] [Full Text] [Related]

  • 4. Homozygous deletion of six olfactory receptor genes in a subset of individuals with Beta-thalassemia.
    Van Ziffle J, Yang W, Chehab FF.
    PLoS One; 2011 Feb 24; 6(2):e17327. PubMed ID: 21390308
    [Abstract] [Full Text] [Related]

  • 5.
    ; . PubMed ID:
    [No Abstract] [Full Text] [Related]

  • 6.
    ; . PubMed ID:
    [No Abstract] [Full Text] [Related]

  • 7.
    ; . PubMed ID:
    [No Abstract] [Full Text] [Related]

  • 8. A novel (g)gamma(a)gamma(deltabeta)O-thalassemia with a 27 kb deletion.
    Yamashiro Y, Hattori Y, Okayama N, Shinoda E, Suyama N, Tanaka T, Ohi S.
    Hemoglobin; 2005 Feb 24; 29(3):197-208. PubMed ID: 16114183
    [Abstract] [Full Text] [Related]

  • 9.
    ; . PubMed ID:
    [No Abstract] [Full Text] [Related]

  • 10.
    ; . PubMed ID:
    [No Abstract] [Full Text] [Related]

  • 11.
    ; . PubMed ID:
    [No Abstract] [Full Text] [Related]

  • 12. A novel (A)γδβ(0)-thalassemia caused by DNA deletion-inversion-insertion of the β-globin gene cluster and five olfactory receptor genes: Genetic interactions, hematological phenotypes and molecular characterization.
    Singha K, Fucharoen G, Hama A, Fucharoen S.
    Clin Biochem; 2015 Jul 24; 48(10-11):703-8. PubMed ID: 25866400
    [Abstract] [Full Text] [Related]

  • 13.
    ; . PubMed ID:
    [No Abstract] [Full Text] [Related]

  • 14. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.
    Rizo-de-la-Torre LC, Ibarra B, Sánchez-López JY, Magaña-Torres MT, Rentería-López VM, Perea-Díaz FJ.
    Int J Lab Hematol; 2017 Oct 24; 39(5):539-545. PubMed ID: 28603845
    [Abstract] [Full Text] [Related]

  • 15.
    ; . PubMed ID:
    [No Abstract] [Full Text] [Related]

  • 16.
    ; . PubMed ID:
    [No Abstract] [Full Text] [Related]

  • 17. Identification of a novel δ-globin gene mutation in an Iranian family.
    Amirian A, Jafarinejad M, Kordafshari AR, Mosayyebzadeh M, Karimipoor M, Zeinali S.
    Hemoglobin; 2010 Oct 24; 34(6):594-8. PubMed ID: 21077769
    [Abstract] [Full Text] [Related]

  • 18. Prevalence of -alpha(3.7) and alpha alpha alpha(anti3.7) alleles in sickle cell trait and beta-thalassemia patients in Mexico.
    Nava MP, Ibarra B, Magaña MT, de la Luz Chávez M, Perea FJ.
    Blood Cells Mol Dis; 2006 Oct 24; 36(2):255-8. PubMed ID: 16466950
    [Abstract] [Full Text] [Related]

  • 19.
    ; . PubMed ID:
    [No Abstract] [Full Text] [Related]

  • 20.
    ; . PubMed ID:
    [No Abstract] [Full Text] [Related]


    Page: [Next] [New Search]
    of 5.