These tools will no longer be maintained as of December 31, 2024. Archived website can be found here. PubMed4Hh GitHub repository can be found here. Contact NLM Customer Service if you have questions.


Pubmed for Handhelds

PUBMED FOR HANDHELDS

Journal Abstract Search

932 related items for PubMed ID: 27263053

  • 21. Distribution of HBB Gene Mutations in the Kurdish Population of Ilam Province, West Iran.
    Moradi K, Aznab M, Tahmasebi S, Omidniakan L, Bijari N, Alibakhshi R.
    Hemoglobin; 2020 Jul; 44(4):244-248. PubMed ID: 32869674
    [Abstract] [Full Text] [Related]

  • 22. Association of Hb A2 Variants with Several Forms of α- and β-Thalassemia in Thailand.
    Panyasai S, Pornprasert S.
    Hemoglobin; 2020 May; 44(3):179-183. PubMed ID: 32482156
    [Abstract] [Full Text] [Related]

  • 23. Molecular analysis of β-thalassemia patients: first identification of mutations HBB:c.93-2A>G and HBB:c.114G>A in Brazil.
    Fernandes AC, Shimmoto MM, Furuzawa GK, Vicari P, Figueiredo MS.
    Hemoglobin; 2011 May; 35(4):358-66. PubMed ID: 21797703
    [Abstract] [Full Text] [Related]

  • 24. The Frequency of HBB Mutations Among β-Thalassemia Patients in Hamadan Province, Iran.
    Jalilian M, Azizi Jalilian F, Ahmadi L, Amini R, Esfehani H, Sosanian M, Rabbani B, Maleki M, Mahdieh N.
    Hemoglobin; 2017 Jan; 41(1):61-64. PubMed ID: 28391758
    [Abstract] [Full Text] [Related]

  • 25. Molecular and phenotype characterization of an elongated β-globin variant produced by HBB:C.313delA.
    Lin W, Zhang Q, Shen Z, Qu X, Wang Q, Wei L, Qiu Y, Yang J, Xu X, Lao J.
    Int J Lab Hematol; 2021 Dec; 43(6):1620-1627. PubMed ID: 34271589
    [Abstract] [Full Text] [Related]

  • 26. A Clinical Update of the Hb Siirt [β27(B9)Ala→Gly; HBB: c.83C>G] Hemoglobin Variant.
    Cappabianca MP, Colosimo A, Sabatucci A, Dainese E, Di Biagio P, Piscitelli R, Sarra O, Zei D, Amato A.
    Hemoglobin; 2017 Jan; 41(1):53-55. PubMed ID: 28391745
    [Abstract] [Full Text] [Related]

  • 27. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients.
    Rizo-de-la-Torre LC, Ibarra B, Sánchez-López JY, Magaña-Torres MT, Rentería-López VM, Perea-Díaz FJ.
    Int J Lab Hematol; 2017 Oct; 39(5):539-545. PubMed ID: 28603845
    [Abstract] [Full Text] [Related]

  • 28. Mutational analysis of hemoglobin genes and functional characterization of detected variants, through in-silico analysis, in Pakistani beta-thalassemia major patients.
    Ejaz S, Abdullah I, Usman M, Iqbal MA, Munawar S, Khan MI, Imtiaz N, Tahir H, Bari MI, Rasool T, Fatima A, Anwar R, Durrani A, Hameed Y.
    Sci Rep; 2023 Aug 14; 13(1):13236. PubMed ID: 37580329
    [Abstract] [Full Text] [Related]

  • 29. Prenatal screening for β-thalassemia major reveals new and rare mutations in the Pakistani population.
    Moatter T, Kausar T, Aban M, Ghani S, Pal JA.
    Int J Hematol; 2012 Apr 14; 95(4):394-8. PubMed ID: 22392582
    [Abstract] [Full Text] [Related]

  • 30. Presentation of two new mutations in the 3'untranslated region of the β-globin gene and evaluating the molecular spectrum of thalassemia mutations in the Mediterranean region of Turkey.
    Arpaci A, Gul BU, Ozcan O, Ilhan G, El C, Dirican E, Elmacioglu S, Kaya H.
    Ann Hematol; 2021 Jun 14; 100(6):1429-1438. PubMed ID: 33851260
    [Abstract] [Full Text] [Related]

  • 31. Combined Gap-Polymerase Chain Reaction and Targeted Next-Generation Sequencing Improve α- and β-Thalassemia Carrier Screening in Pregnant Women in Vietnam.
    Lam TT, Nguyen DT, Le QT, Nguyen DA, Hoang DT, Nguyen HD, Nguyen CC, Doan KPT, Tran NT, Ha TMT, Trinh THN, Nguyen VT, Lam DT, Le MT, Nguyen XT, Ho TT, Tran TH, Ho VT, Bui TV, Nguyen VT, Hoang PB, Nguyen HT, Nguyen MH, Vo TB, Le DN, Truong TN, Dao HT, Vo PN, Nguyen TV, Tran NT, Tran QT, Van YT, Nguyen TT, Huynh BT, Nguyen TT, Tran KT, Nguyen CT, Doan PL, Nguyen TD, Do TT, Truong DK, Tang HS, Cao NT, Phan MD, Giang H, Nguyen HN.
    Hemoglobin; 2022 Jul 14; 46(4):233-239. PubMed ID: 35993587
    [Abstract] [Full Text] [Related]

  • 32. Two novel mutations in the 3' untranslated region of the beta-globin gene that are associated with the mild phenotype of beta thalassemia.
    Bilgen T, Clark OA, Ozturk Z, Akif Yesilipek M, Keser I.
    Int J Lab Hematol; 2013 Feb 14; 35(1):26-30. PubMed ID: 22862814
    [Abstract] [Full Text] [Related]

  • 33. Rare β-Globin Gene Mutations in Pakistan.
    Hussain A, Ahmed S, Ali N, S Mailk H, Anees M, Chuahdry AH, Ahmed P.
    Hemoglobin; 2017 Mar 14; 41(2):100-103. PubMed ID: 28670940
    [Abstract] [Full Text] [Related]

  • 34. Molecular Characterization of β-Thalassemia Mutations Via the Amplification Refractory Mutation System-Polymerase Chain Reaction Method at the North Waziristan Agency, Pakistan.
    Khan NM, Rehman SU, Shakeel M, Khan S, Ahmed U, Rehman H, Yaseen T, Javid A.
    Hemoglobin; 2018 Mar 14; 42(2):91-95. PubMed ID: 30200837
    [Abstract] [Full Text] [Related]

  • 35. A Novel Pathogenic β-Thalassemia Mutation Identified at Codon 8 (HBB: c.27delG) in a Bangladeshi Family Acquired De Novo.
    Hasan KN, Sufian A, Mazumder AK, Khaleque MA, Rahman M, Akhteruzzaman S.
    Hemoglobin; 2019 May 14; 43(3):162-165. PubMed ID: 31339392
    [Abstract] [Full Text] [Related]

  • 36. The Spectrum of β-Thalassemia Mutations in Siirt Province, Southeastern Turkey.
    Yılmaz S.
    Hemoglobin; 2019 May 14; 43(3):174-181. PubMed ID: 31411089
    [Abstract] [Full Text] [Related]

  • 37. Molecular Characterization and Hematological Aspects of Hb E-Myanmar [β26(B8)Glu→Lys and β65(E9)Lys→Asn, HBB: c.[79G>A;198G>C]): A Novel β-Thalassemic Hemoglobin Variant.
    Satthakarn S, Boonmee S, Panyasai S.
    Hemoglobin; 2020 Nov 14; 44(6):385-390. PubMed ID: 33222574
    [Abstract] [Full Text] [Related]

  • 38. Frequency of Gγ-globin promoter -158 (C>T) XmnI polymorphism in patients with homozygous/compound heterozygous beta thalassaemia.
    Ali N, Ayyub M, Khan SA, Ahmed S, Abbas K, Malik HS, Tashfeen S.
    Hematol Oncol Stem Cell Ther; 2015 Mar 14; 8(1):10-5. PubMed ID: 25591326
    [Abstract] [Full Text] [Related]

  • 39. β-Thalassemia major resulting from compound heterozygosity for HBB: c.92+2T>C [formerly known as IVS-I-2 (T>C)] and a novel β(0)-thalassemia frameshift mutation: HBB: c.209delG; p.Gly70Valfs*20.
    Kluge ML, Hoyer JD, Swanson KC, Oliveira JL.
    Hemoglobin; 2014 Mar 14; 38(4):292-4. PubMed ID: 24986053
    [Abstract] [Full Text] [Related]

  • 40. Characterization of Deletions of the HBA and HBB Loci by Array Comparative Genomic Hybridization.
    Sabath DE, Bender MA, Sankaran VG, Vamos E, Kentsis A, Yi HS, Greisman HA.
    J Mol Diagn; 2016 Jan 14; 18(1):92-9. PubMed ID: 26612711
    [Abstract] [Full Text] [Related]

    Page: [Previous] [Next] [New Search]
    of 47.