These tools will no longer be maintained as of December 31, 2024. Archived website can be found here. PubMed4Hh GitHub repository can be found here. Contact NLM Customer Service if you have questions.
Pubmed for Handhelds
PUBMED FOR HANDHELDS
Journal Abstract Search
171 related items for PubMed ID: 33966551
21. Updated Molecular Spectrum of β-Thalassemia Mutations in Duhok Province, Northern Iraq: Ethnic Variation and the Impact of Immigration. Atroshi SD, Al-Allawi NAS, Eissa AA. Hemoglobin; 2021 Jul; 45(4):239-244. PubMed ID: 34794358 [Abstract] [Full Text] [Related]
22. Primer-introduced restriction analysis polymerase chain reaction method for non-invasive prenatal testing of β-thalassemia. Liu S, Chen L, Zhang X, Li J, Lin H, Liu L, Xie J, Ge H, Ye M, Chen C, Ji X, Zhang C, Xu F, Jiang H, Zhen H, Chen S, Wang W. Hemoglobin; 2015 Jul; 39(1):18-23. PubMed ID: 25548039 [Abstract] [Full Text] [Related]
23. Molecular Characterization of β- and α-Globin Gene Mutations in Individuals with Borderline Hb A2 Levels. Satthakarn S, Panyasai S, Pornprasert S. Hemoglobin; 2020 Sep; 44(5):349-353. PubMed ID: 33023363 [Abstract] [Full Text] [Related]
24. Three novel HBB mutations, c.-140C>G (-90 C>G), c.237_256delGGACAACCTCAAGGGCACCT (FS Cd 78/85 -20 bp), and c.315+2T>G (IVS2:2 T>G). Update of the mutational spectrum of β-Thalassemia in Mexican mestizo patients. Rizo-de-la-Torre LC, Ibarra B, Sánchez-López JY, Magaña-Torres MT, Rentería-López VM, Perea-Díaz FJ. Int J Lab Hematol; 2017 Oct; 39(5):539-545. PubMed ID: 28603845 [Abstract] [Full Text] [Related]
25. Molecular basis of β-thalassemia in the western province of Saudi Arabia: identification of rare β-thalassemia mutations. Abuzenadah AM, Hussein IM, Damanhouri GA, A-Sayes FM, Gari MA, Chaudhary AG, Zaher GF, Al-Attas A, Al-Qahtani MH. Hemoglobin; 2011 Oct; 35(4):346-57. PubMed ID: 21797702 [Abstract] [Full Text] [Related]
30. Molecular spectrum of β-thalassemia in Fujian Province, Southeastern China. Huang H, Xu L, Lin N, He D, Li Y, Guo D, Wang L, Wang Y, Zhen L, Xu J, Lin Y. Hemoglobin; 2013 Oct; 37(4):343-50. PubMed ID: 23682686 [Abstract] [Full Text] [Related]
31. Molecular Characterization of β-Thalassemia Mutations Via the Amplification Refractory Mutation System-Polymerase Chain Reaction Method at the North Waziristan Agency, Pakistan. Khan NM, Rehman SU, Shakeel M, Khan S, Ahmed U, Rehman H, Yaseen T, Javid A. Hemoglobin; 2018 Mar; 42(2):91-95. PubMed ID: 30200837 [Abstract] [Full Text] [Related]
32. Hb S/β-Thalassemia in the REDS-III Brazil Sickle Cell Disease Cohort: Clinical, Laboratory and Molecular Characteristics. Belisário AR, Carneiro-Proietti AB, Sabino EC, Araújo A, Loureiro P, Máximo C, Flor-Park MV, Rodrigues DDOW, Ozahata MC, McClure C, Mota RA, Gomes Moura IC, Custer B, Kelly S, Recipient Epidemiology and Donor Evaluation Study (REDS-III) International Component Brazil. Hemoglobin; 2020 Jan; 44(1):1-9. PubMed ID: 32172616 [Abstract] [Full Text] [Related]
37. Identification of three novel mutations [-41 (A>C), codon 24 (-G), and IVS-I-109 (-T)], in a study of beta-thalassemia alleles in the Isfahan region of Iran. Salehi R, Fisher CA, Bignell PA, Eslami G, Old JM. Hemoglobin; 2010 Jan; 34(1):115-20. PubMed ID: 20113296 [Abstract] [Full Text] [Related]